GP13, an Arthrospira platensis cysteine desulfurase-derived peptide, suppresses oxidative stress and reduces apoptosis in human leucocytes and zebrafish (Danio rerio) embryo via attenuated caspase-3 expression

2.1 Spirulina culture and challenge study

Spirulina, obtained from the S.R.M Lake (12.825527° N 80.039606° E, Tamil Nadu, India), was cultured in a modified Zarrouk’s medium at 30 °C (pH 9.5) at 12/12-h light/dark cycle. Species was identified using 16s rRNA sequencing. Under optimum culture condition, spirulina was subjected to a stress, caused by sulfur-deprivation in the culture media (Kumaresan et al., 2017). Growth rate was monitored on alternative days until day-20 using a spectrophotometer (SHIMADZU). Chlorophyll absorption was estimated at 655 nm.

2.2 ApCDS gene expression study

Spirulina was harvested during the sulfur-deprivation periods (0, 5, 10, 15, and 20th days) and flash frozen in LN₂. Using TRIzol, RNA was isolated as per the manufacturer’s protocol (Life Technologies, Rockville, USA). Isolated RNA was used for cDNA synthesis. ApCDS expression was analysed using cDNA as a template. Following ApCDS primers were used; Forward: GGACAAGCACTCAACCAAGA; Reverse: GGACGCACAGTTACCTCTAAAC. For internal control, 16s rRNA was used; whose primer details are: Forward: GCTTTCCCGACTTGTGGATTA; Reverse: CCCTACCTTGTCCAACAATACC. For the assay, SYBR Green Master Mix (Roche Diagnostics) was utilized. Spirulina culture, which was not deprived of sulfur, served as control. Results were obtained in triplicates.

2.3 ApCDS cDNA sequence analysis

Blast2go program identified the full-length sequence of ApCDS cDNA from our previously established spirulina transcriptome. The identified ApCDS cDNA sequence was submitted to EMBL. Expasy translate tool was used to check the ApCDS protein parameters. Physio-chemical properties of cDNA and protein (molecular weight, isoelectric point, open reading frame, and hydrophobicity) were analyzed. Phylogenetic tree, multiple sequence analysis, 2D and 3D structures were predicted using multiple online bioinformatics tools.

2.4 GP13 peptide analysis

Using in silico analysis GP13 peptide ¹GIAVRAGHHCAQP¹³ was identified from the CDS domain of ApCDS. Expasy Prot-Param tool (https://web.expasy.org/protparam) predicted that GP13 has antioxidant property, based on its hydrophobicity, molecular weight, arrangement of amino acids, and evolutionary conserved sequence. Helical Wheel Projection (http://www.bioinformatics.nl/cgi-bin/emboss/pepwheel) identified the hydrophobicity and helical structure of GP13. According to the bioinformatics output, GP13 was synthesized, HPLC-purified, and its sequence was evaluated (MALDI-TOF MS analysis) at Zhengzhou Peptides Pharmaceutical Technology Co. Ltd, China. Peptide stock of 1 mM in PBS was utilized for the assays.

2.5 In vitro ROS scavenging activity of GP13

To evaluate the peptide’s antioxidant potential, antioxidant assays were performed using a UV–Vis spectrophotometer (UV 1800, SHIMADZU, Japan). Trolox was used for positive control.

2.6 Hemolytic assay

Human blood was collected from a healthy volunteer (Ethical Approval No. CDRI/IEC/2014/A1). Whole blood was centrifuged at 1000 rpm for 10 min at 4 °C to remove plasma; blood cells were washed thrice in PBS. Leucocytes were then isolated from blood cells (Arasu et al., 2017). Cells, exposed to different peptide concentrations, were incubated at RT for 1 h. After incubation, samples were centrifuged for 5 min at 4000 rpm. Then, the supernatant was diluted with PBS, and the absorbance was measured at 560 nm.

2.7 MTT assay

To analyze whether or not GP13 influences cell viability, MTT assay in Vero cells (obtained from The King Institute of Preventive Medicine and Research, Guindy, Chennai, India) was performed (Mosmann, 1983). Cells were plated in a 96 well-plate (1X10⁵ cells/well) and grown till 80 percent confluence. Different concentrations of GP13 (10–80 μM) were used for a 24 h challenge on the cells and the reading was taken at 570 nm using a microplate reader (LIZA).

2.8 Intracellular ROS on leucocytes

Leucocytes were seeded in 6-well plates and incubated with DCFH-DA (10 µM) and H₂O₂ (1 mM) for 30 min at 37 °C, followed by the peptide treatment at different concentrations (10–80 μM). Cells not exposed to H₂O₂ served as control. Quantity of fluorescent intensity was measured by Image J software (Sannasimuthu et al., 2018).

2.9 H₂O₂-induced cell apoptosis

The efficacy of GP13 on H₂O₂-stimulated apoptosis in Vero cells were evaluated as described (Kang et al., 2013). Cells were treated with different peptide concentrations, with or without H₂O₂ (1 mM) for 6 h. Cells not exposed to H₂O₂ served as control. Treated cells were then stained with the cell permeable Hoechst-33342. After 10 min incubation, cells were observed under a fluorescent microscope.

2.10 Lipid-peroxidation assay

For the MDA assay (Ohkawa et al., 1979), peptide treated cells were incubated with 1% thiobarbituric acid, 0.37% sodium dodecyl sulphate, and 6.8% acetic acid for 2 h at 95 °C. Reaction mixture was cooled at RT, then N-butanol and pyridine were added at 15:1 ratio and vortexed. Reaction mix was centrifuged at 3000 rpm for 15 min, and readings were measured at 532 nm.

2.11 Zebrafish maintenance and embryo collection

Four months-old male and female zebrafish (Wild type-AB) were taken from a commercial market at Kolathur, Chennai, Tamil Nadu. They were left undisturbed in the laboratory for two weeks, for acclimatization. Then, they were processed for breeding with a breeding set of 1-female: 2-male ratio. Embryos were collected in a petridish containing E3 media, where healthy and dead embryos were separated. Stable embryos at 6hpf were chosen for further analysis by examining them under a compound microscope.

2.12 GP13 peptide toxicity analysis

In a 6-well plate about 3-4hpf, embryos (16/well) were exposed to different peptide concentrations (10–80 μM) in E3 medium. Embryos which were subjected to OS using 1 mM H₂O₂ served as positive control. Developmental parameters were observed every day at an interval of 24 h, upto 96hpf.

2.13 Antioxidant-enzyme assay

Antioxidant-enzyme activity was assessed using 96hpf-embryos. Zebrafish larvae in E3 medium were exposed to GP13 in Tris buffer with 1 mM H₂O₂ for 2 days. Samples were then homogenized and separated by centrifugation at 2500 rpm for 10 min at 4 °C. Supernatant was utilized for the assay.

Superoxide dismutase (SOD) activity was performed to examine the enzyme's tendency to resist superoxide anion-induced epinephrine autoxidation. The embryo supernatant was incubated for 3 min with a mixture containing epinephrine (5 mg/mL), bovine catalase (0.4U/mL) and NaHCO₃ buffer. Absorbance was measured at 480 nm·H₂O₂ disappearance was represented as U/mL (Hamdi et al., 2011).

Phosphate buffer containing 200 μM H₂O₂ was applied to an experimental cuvette. Catalase (CAT) enzyme activity was determined using a mixture of the supernatant and peptide after 1 min incubation; this reaction mixture was read at 240 nm. Absorbance could decrease when the H₂O₂ gets degraded due to CAT (Hadwan, 2018).

In lipid-peroxidation assay, MDA concentration in the supernatant of zebrafish larvae was measured (Adeyemi et al., 2015). Thiobarbituric acid (TBA) was added to the supernatant and incubated for 10 min in a water bath at 95 °C, and was read at 532 nm.

2.14 DCFH-DA analysis in zebrafish embryo

Untreated control and GP13 treated (10–80 μM) 96hpf-embryos were collected in 6-well plates containing E3 medium. To induce OS, treated embryos were incubated for 1 h with H₂O₂ and then washed with PBS. ROS intensity was examined using the larvae stained with DCFH-DA (10 μM) under Leica fluorescent microscope and the florescent photographs were recorded. Software Image J measured the intensity of the fluorescence.

2.15 Detection of activated caspase-3 expressions to analyze apoptosis

Zebrafish larvae (96 hpf) were collected in a 1.5 mL tube and rinsed twice with 1 mL of 1x PBST. Embryos were fixed using para-formaldehyde (4%) and incubated at 4 °C, overnight. Methanol was used to permeabilize the larvae; after permeabilization, 1 mL PDT (1x PBST, 0.3% Triton-X, 1% DMSO) was applied. After 30 min exposure, PDT was discarded, then blocking buffer was applied. Rabbit anti-activated caspase-3 antibody was used for incubation, to block the process, preceded by the incubation of the secondary antibody (anti-Rabbit, Dylight 488, Rockl and antibodies & assays, USA), which continued for 8 h (Sorrells et al., 2013). Finally, the larvae were washed and observed under a fluorescent microscope.

2.16 Real-time PCR study

After the exposure experiments, the 96hpf zebrafish larvae (n = 40) were homogenised, and total RNA was extracted using TRIZOL. mRNA was converted to cDNA and real-time-PCR experiment was conducted (KAPA BIOSYSTEM kit). After normalising with β-actin, the ΔΔct value was determined, and the fold change was evaluated using the 2^-ΔΔt technique. Primer sequences utilized are described elsewhere (Issac et al., 2021).

2.17 Statistics

All the results were taken in triplicates indicating Mean ± SD . Statistical analysis was done Bonferroni post-hoc test and Tukey’s multiple comparison test in Graph Pad Prism (ver. 5.0) were performed.

3.1 ApCDS sequence analysis

Length of the ApCDS cDNA sequence was 1878 bp, with the protein containing 625 amino acids and molecular mass of 68.120 kDa. Encoded protein contains 69 negatively charged residues (Asp + Glu) and 48 positively charged residues (Arg + Lys) with an isoelectric point of 5.52. Instability index of 39.47 indicates ApCDS as a stable protein (E-Suppl. Table 1). ApCDS polypeptide contains cysteine desulfurase (SufS) domain at 243–616, forming the biggest part that belongs to the pyridoxal phosphate dependent aspartate aminotransferase superfamily. The SufS domain has aminotransferase class-V domain at 244–612, the chemical binding site at T³¹²-T³¹³; I³¹⁶; H³³⁴; D⁴¹⁷; S⁴¹⁹-Q⁴²⁰; T⁴³⁴; H⁴³⁶-K⁴³⁷ and active site at K⁴³⁷ (E-Suppl. Fig. 1). Multiple sequence analysis shows similarity with Helianthus annus (49.12%), Coffea arabica (48.61%), Cucurbita maxima (48.1%), and Momordica charantia (47.6%) (E-Suppl. Fig. 2). Clustal Omega Program revealed the homology of the sequences, in which the CDS functional regions were strongly conserved; while the semi-conserved regions in CDS had molecular potential.

In the secondary structure, Prabi-Gerland tool revealed the presence of 30.88% alpha-helix, 12.64% of extended strand and 56.48% of random coil. Based on the C-score (-2.59), RMSD value 14.3 ± 3.8 Å and TM score 0.41 ± 0.14, the best structure of ApCDS 3D was obtained from I-TASSER tool. The Ramachandran Plot revealed that 71.9% of amino acid residues are in the favourable region, 14.1% in allowed region and outlier region (14%) of ApCDS. Report shows that the c-value of the best model is −3.29, RMSD 11.3 ± 4.8 Å and TM score 0.35 ± 0.12, which is similar to our selected model (Das and Roychoudhury, 2014).

3.2 Characterisation of GP13 peptide

A peptide sequence ⁵⁷³GIAVRAGHHCAQP⁵⁸⁵ named GP13 has been identified based on the highly conserved regions using bioinformatics analysis from ApCDS (E-Suppl. Fig. 2). HPLC analysis identified that the peptide has 95.9% purity.

3.3 ApCDS gene expression analysis

ApCDS mRNA expression was analyzed at various time intervals. On 10th, 15th^, and 20th days (Fig. 1), mRNA levels were significantly increased. However, the expression on the day-15 was maximum than the other days.

Close

Fig. 1

Gene expression patterns of ApCDS by qRT-PCR. Data are expressed as a relative fold calculated against the internal control 16 s rRNA at different intervals of time (0, 5, 10, 15, and 20 days). Values are shown as mean ± standard deviation (SD) of three replicates. The asterisk (*) represents p < 0.05 compared to their respective controls by one-way ANOVA followed by Bonferroni post-hoc test using Graph Pad Prism 5.0.

Export to PPT

3.4 In vitro antioxidant activity of GP13

Free-radical scavenging activity of GP13 was significantly higher (72%) at 80 µM and lower (49%) at 10 µM than Trolox (96.5% at 80 µM and 84% at 10 µM) (E-Suppl. Fig. 4A).

In the ABTS radical scavenging assay, GP13 showed significantly (p < 0.05) higher activity at 80 µM (91%) with a gradual decrease (69%) at 10 µM.

Hydroxyl scavenging activity of GP13 was significantly increased (72.3%) at 80 μM and reduced (48.1%) at 10 μM. At the same time, Trolox exhibited significantly (p < 0.05) higher activity (89.1% at 80 µM) as provided in E-Suppl. Fig. 4C.

Results demonstrate that GP13 at 80 µM has significantly (p < 0.05) higher superoxide anion radical scavenging activity (85.2%), almost similar to positive control, Trolox (94.3% at 80 µM) that is nearly similar to GP13 peptide activity (E-Suppl. Fig. 4D).

3.5 Haemolytic assay and intracellular ROS on leucocytes

GP13 showed no hemolytic effect even at the highest concentration (80 µM). (Fig. 2). The H₂O₂-treated larvae showed an increase in fluorescence intensity of upto 99% in the zebrafish larvae, which indicates the oxidatively stressed condition (Fig. 3). In the GP13-treated group (80 µM), there was a decrease in fluorescence intensity to 39%.

Close

Fig. 2

Hemolytic assay was performed on human whole blood with Triton X (0.01%) as positive control and PBS as control. Values are shown in mean ± SD of three replicates. The asterisk (*) represents the significance (p < 0.05) of peptide compared with control measured by one-way ANOVA followed by Bonferroni post-hoc test using Graph Pad Prism 5.0.

Export to PPT

Close

Fig. 3

The Reduction of intracellular ROS production in human leucocytes treated by different concentration of GP13 and stained using DCFH-DA dye presented in microscopic images (magnification = 10X and scale bar = 100 µm). (A) Control (untreated cells), (B) H₂O₂ treated cells (C) H₂O₂ (1 mM) + 10 µM GP13, (D) H₂O₂ (1 mM) + 20 µM GP13, (E) H₂O₂ (1 mM) + 40 µM GP13, (F) H₂O₂ (1 mM) + 80 µM GP13, and (G) Quantitative analysis analysis of ROS production at different concentration of GP13 peptide treatment. Values were presented as mean ± SD (n = 3). The asterisk (*) represents the significance at p < 0.05 between the GP13 peptide treatment and control groups.

Export to PPT

Close

Fig. 4

Cell viability test in Vero cells. MTT assay was performed on vero cells with GP13 peptide at different concentration (10–80 μM) where PBS treatment as control. Triton X (0.01%) was used as a positive control. Bar diagram showed the cell viability on treatment with different concentration of peptide measured in Microplate Reader (n = 3). Data were expressed as mean ± SD.

Export to PPT

3.6 Cell viability, apoptosis, and lipid-peroxidation assay on Vero cells

GP13 had no cytotoxic effect at all the concentrations used (10–80 µM) (Fig. 4). Hoechst dye identifies cell death through the presence of apoptotic cells. Results reveal the brightly stained condensed nuclei in H₂O₂-induced Vero cells (99%) than the control (untreated cells). Although this H₂O₂-induced effect was countered by GP13 exposure at different concentrations (10–80 µM), the maximum reduction in apoptosis was observed in 80 µM (32%) (Fig. 5). The protective effect of GP13 against H₂O₂-induced lipid-peroxidation in Vero cells is shown in Fig. 6. Maximum reduction in MDA concentration was shown in 80 µM of GP13.

Close

Fig. 5

Effect of GP13 peptide on H₂O₂ induced stress against apoptosis in Vero cells. The apoptotic body formation was observed under fluorescent microscope after Hoechst 33342 staining (A) Control (untreated cells), (B) H₂O₂ (1 mM), (C) H₂O₂ (1 mM) + 10 µM GP13, (D) H₂O₂ (1 mM) + 20 µM GP13, (E) H₂O₂ (1 mM) + 40 µM GP13 and (F) H₂O₂ (1 mM) + 80 µM GP13. (G) Apoptosis level was measured using Image J software. The experiments were conducted in triplicates. The asterisk (*) represents the significance at p < 0.05 between treatment and control by one-way ANOVA followed by Bonferroni post-hoc test using Graph Pad Prism 5.0.

Export to PPT

Close

Fig. 6

Effect of GP13 on lipid peroxidation level in oxidative stressed Vero cells. Different concentrations of GP13 treated along with H₂O₂ (1 mM) showed a reduction in lipid level·H₂O₂ treated cells as a positive control. Values are shown in mean ± SD of three replicates. The asterisk (*) represents the significance (p < 0.05) between peptide treated and control (untreated cells), H₂O₂ measured using one-way ANOVA followed by Bonferroni post-hoc test using Graph Pad Prism 5.0.

Export to PPT

3.7 Toxicity study in zebrafish embryo

GP13 peptide treated zebrafish larvae at a various concentrations (10–80 µM) did not show any adverse effect in the morphology and survival rate of the larvae, whereas the H₂O₂ (1 mM) treated larvae showed mortality and malformations (Fig. 7 & E-Suppl. Fig. 5). Heart rate was evaluated at 72hpf to identify the cardiotoxicity of GP13. There was a reduction in heart rate in the H₂O₂-exposed group, while there was no significant change in the heartbeat even at the maximum concentration (80 µM) of GP13 (E-Suppl. Fig. 5).

Close

Fig. 7

Representative photomicrographs of morphological malformation were observed during the exposure period. Control with E3 medium treatment and GP13 peptide at different concentrations showed no developmental toxicity, whereas the H₂O₂ (1 mM) treatment group was observed with malformations such as yolk sac edema (YSE).

Export to PPT

3.8 Antioxidant-enzyme activity in zebrafish larvae

Antioxidant-enzyme activities (SOD and CAT) of GP13 was estimated in the H₂O₂-stressed larvae supernatant. SOD (9U/mL) and CAT (4U/mL) activities were remarkably decreased in the H₂O₂ treated group. Meanwhile, the GP13 peptide at 80 μM showed a higher level of SOD (34U/mL) and CAT (22U/mL) activity than the control.

The H₂O₂ induced group found to have increased lipid-peroxidation levels (30 nmol/mL) than the control group (E-Suppl. Fig. 6C). Parallely, there was a decrease in lipid-peroxidation levels in the GP13-exposed group. A higher level of lipid-peroxidation inhibition was observed in 80 µM (14 nmol/mL). Overall, results show that GP13 normalizes the harmful effect of free-radicals by enhancing the antioxidant-enzymes.

3.9 ROS scavenging effect of GP13 on zebrafish embryo

The ability of GP13 to scavenge ROS in H₂O₂-treated zebrafish larvae was evaluated through the observed changes in the degree of fluorescence intensity. Mean fluorescence intensity was found to be significantly (p < 0.01) higher in the H₂O₂-induced group than the control. However, the group which was pre-treated with GP13 showed a reduction in the mean fluorescent intensity (Fig. 8).

Close

Fig. 8

Production of reactive oxygen species (Intracellular ROS levels) measured using DCFH-DA dye in 96 hpf zebrafish larvae. (A) Fluorescent images represent the exposure against various concentration of GP13 along with H₂O₂ (1 mM) (B) Fluorescent intensity measured using Image J software presented in graphical representation. H₂O₂ was used as a positive control. The values were presented in mean (n = 3). The single asterisk (*) represents the significance at p < 0.05 between the GP13 exposed and control (without treatment) by one-way ANOVA and Bonferroni post Hoc test in Graph Pad 5.0.

Export to PPT

3.10 Caspase-3- dependent apoptosis on zebrafish embryo and antioxidant gene expression study

At 80 μM, GP13 demonstrated better activity with no toxicity effect. Thus 40 μM was selected for further analyses. Changes in activated caspase expression was evaluated in the presence or absence of H₂O₂ and GP13 using the whole mount immunofluorescence method. The intensity was higher in the H₂O₂-treated embryos than the control due to an increase in the number of apoptotic cells. However, this H₂O₂-mediated effect was ameliorated in the combined challenge of GP13 (80 μM) + H₂O₂ (Fig. 9). It is well-known that apoptosis is mediated by caspases, which exist in all cells as pro-caspases (inactive form). Antioxidant gene expression under H₂O₂-induced stress showed decreased mRNA expression in GPx, GSH and GCS than the GP13 pre-treated groups (Fig. 10).

Close

Fig. 9

Effect of GP13 on caspase 3 expression in zebrafish larvae (A) Fluorescence photomicrographs of zebrafish larvae (96 hpf) showing the active caspase 3 expressions. (B) Quantitative bar diagram of active caspase 3 expressions in 96 hpf zebrafish larvae calculated using Image J software. The untreated zebrafish larvae were used as the control. Experiments are performed in triplicate and expressed as mean ± SD. *p < 0.05 and *p < 0.01 indicating the fluorescence intensity significant level between GP13 treated and control.

Export to PPT

Close

Fig. 10

Antioxidant gene expression analysis by qRT-PCR assay. Experiments performed to confirm the antioxidant gene glutathione-S-transferase (GST), glutathione peroxidase (GPx) and gamma-glutamylcysteine synthetase (GCS) levels in the zebrafish embryo after treatment with 80 µM of GP13 peptide and then H₂O₂. Relative gene levels in the treated or un-treated controls. The asterix indicates the significant difference (*p < 0.05 and **p < 0.01) due to Bonferroni post-hoc test performed in Graph Pad Prism 5.0.

Export to PPT