Genetic diversity and antifungal activities of the genera Streptomyces and Nocardiopsis inhabiting agricultural fields of Tamil Nadu, India

2.1 Sample collection

A total of 40 soil samples including rhizosphere of different crops and bulk soils were collected in sterile bags from various locations in Tamil Nadu, India, details of the samples are depicted in Table 1. For rhizosphere samples, standing crops were uprooted at five random sites in a field and soils adhered to the roots were collected in a sterile poly bag. For bulk soil, the top 15 cm soil core was collected from five random sites in a sterile poly bag from each site. The samples once brought to the laboratory were shade dried aseptically and stored in a cold room (4 °C) until further processing.

2.2 Isolation of actinomycetes from soil

A selective media containing basal nutrients and antibiotics was used for the isolation of Streptomyces. Starch casein agar (SCA) containing soluble starch 10 gL^-1, casein 0.3 gL^-1, KNO₃ 2.0 gL^-1, MgSO₄·7H₂O 0.05 gL^-1, K₂HPO₄ 2.0 gL^-1, NaCl 2.0 gL^-1, CaCO₃ 0.02 gL^-1, FeSO₄·7H₂O 0.01 gL^-1 and Agar 20.0 gL^-1 supplemented with cycloheximide (50 mg/L), nystatin (50 mg/L) and rifampicin (50 mg/L) was used as the selective media (Nolan and Cross, 1988). The pH of the media was adjusted to 7. Standard serial dilution and plating method was followed to isolate Streptomyces. Aliquots (100 µL) of dilutions, 1/1000 and 1/10000 were plated on the selective media and incubated at 30 ± 1 °C for 7–10 days. Plates were observed regularly for the growth of the actinomycetes population. Different morphotypes from each of the samples were picked and purified in the selective media. The isolates were then stored as glycerol stocks (20 %) at −80 °C and slants at 4 °C until further study.

2.3 DNA isolation and 16S rRNA gene sequence amplification

Total DNA was extracted from fully grown actinomycetes cultures using Nucleo-pore gDNA Fungal Bacterial Mini Kit employing the manufacturer’s protocol. The quality of DNA was checked and ensured both by gel electrophoresis and nanodrop. Universal primers pA (AGAGTTTGATCCTGGCTCAG) and pH (AAGGAGGTGATCCAGCCGCA) were used for the amplification of the 16S rRNA gene. The PCR reactions were carried out in a peqSTAR thermal cycler by following the protocols of Kumar et al. (2014) with slight modifications. Briefly, the reactions were carried out in 25 μL volume comprising 12.5 μL Go Taq green Master Mix 2X (Promega, USA), 100 ng of primers (pA and pH), 50 ng DNA template and nuclease free water to adjust the volume. PCR conditions used were as follows; initial denaturation-95 °C for 5 min followed by 35 cycles of denaturation-95 °C for 30 s, annealing-52 °C for 40 s and extension-72 °C for 60 s; and a final extension at 72 °C for 10 min. The amplified PCR products were visualized in 1.5 % agarose gel electrophoresis (stained with ethidium bromide) using a gel documentation system (Bio Rad, USA).

2.4 16S rRNA gene sequencing and phylogenetic analysis

PCR products were purified using Gene JET PCR Purification Kit (Thermo Fisher, USA) and sequenced using the primer 1100R (GGGTTGCGCTCGTTG) (Engelbrektson et al., 2010) at GeneMatrix sequencing facility by following sanger dideoxy sequencing method in an ABI 3130xl Genetic Analyzer. Resultant sequences were then quality filtered in FinchTV and trimmed for better quality sequences (Stucky, 2012). Quality ensured sequences were then used to run a BLAST search against 16S rRNA gene sequences of type species available in EZ Biocloud to identify the isolates (https://www.ezbiocloud.net). Sequences were aligned and compared using the multiple sequence alignment tool, CLUSTAL W and a phylogenetic tree was constructed employing the neighbour joining method (Saitou and Nei, 1987). The Program used for phylogenetic tree construction is MEGA X (Kumar et al., 2018).

2.5 Characterization of soil actinomycetes based on pigment formation, growth pattern and mycelium formation

Cultural characteristics of all the actinomycete isolates were examined on four different ISP (International Streptomyces Project) media viz., ISP1, 2, 3 and 7, incubated at 28 ± 2 °C for 14 days. Morphological characteristics like pigment formation, growth pattern (recorded under three categories viz., poor, moderate and Good) and the colour of aerial and substrate mycelium were recorded.

2.6 Antifungal activity against phytopathogenic fungi

Four phytopathogenic fungi viz., Fusarium udum (NAIMCC-F-02017), Fusarium oxysporum f. sp. ciceris (NAIMCC-F-00889), Macrophomina phaseolina (NAIMCC-F-01260) and Sclerotium rolfsii (NAIMCC-F-01638) were collected from NAIMCC. They were grown on potato dextrose agar plates with an incubation at 28 ± 2 °C for 24–120 h and maintained on PDA slants and mineral oil for further use. Freshly grown cultures were used for antifungal assays. A dual culture assay was employed to test the antagonistic activity of Streptomyces spp. against four selected phytopathogens. SCA and PDA in the ratio of 1:1 was used as a medium to test the antagonistic activity. Fresh cultures of the bacterium were inoculated on two sides of the plate with the selected medium. The centre of the plate was inoculated with fresh mycelium of the test pathogens and the plates were incubated at 28 ± 2 °C for 96 h. Plates were observed twice a day during incubation for inhibition zones. Plates inoculated with test pathogen alone were also incubated simultaneously as a control. The zone of inhibition and percent inhibition of fungi were calculated using the following formula. $$\text{Zone of inhibition}=\text{F}-\text{A}$$ $$\text{Percent inhibition}\left(\text{PI}\right)=\left[\left(\text{F}-\text{A}\right)/\text{F}\right]\times 100$$ where F = radius of fungal growth from the centre (cm) in the control plate.

• A = the radius of radial fungal growth from the centre (cm) in the dual culture plate.

3.1 Actinomycetes community composition

Isolation on the selective media resulted in a total of sixty-five isolates from 40 samples collected from Tamil Nadu (Table 1). Identification based on 16S rRNA gene sequencing and blast search against type species database revealed that these 65 isolates were affiliated to two genera belonging to Streptomyces and Nocardiopsis (Fig. 1).

Close

Fig. 1

Neighbour-joining phylogenetic tree based on 16S rRNA gene sequences showing the relationship between the 45 Streptomyces and 20 Nocardiopsis strains. Bootstrap value based on 1000 resampled datasets are shown at branch nodes.

Export to PPT

3.2 Streptomyces

The genus Streptomyces represents 45 isolates accounting for 67.69 % of the total isolates. It was represented by 18 species viz., S griseus (4), S. anulatus (3), S. microflavus (2), S. covourensis (1), S.araujoniae (3), S. zhihengii (1), S. roseofulvus (3), S. daghestanicus (5), S. carpaticus (1), S. matensis (2), S. glaucescens (1), S. tendae (3), S. nigra (1), S. albogriseolus (1), S. pilosus (1), S. rochei (3), S. bohaiensis (8), S. lonarensis (2).

3.3 Nocardiopsis

Identified isolates include Nocardiopsis representing 32.31 % of the total isolates. Isolates belonging to Nocardiopsis are not as diverse as Streptomyces representing only three species viz., Nocardiopsis dassonvillei (11), Nocardiopsis flavescens (8) and Nocardiopsis listeria (1).

3.4 Phylogenetic diversity of actinomycetes based on 16S rRNA gene sequences

The relationship between the two genera obtained in the present study demonstrated through a phylogenetic tree is presented in Fig. 1. All the 65 strains were grouped into two genera Streptomyces and Nocardiopsis; the upper side of the dendrogram representing Streptomyces with 18 species, S. griseus, S. anulatus, S. microflavus, S. covourensis, S. araujoniae, S. zhihengii, S. roseofulvus, S. daghestanicus, S. carpaticus, S. matensis, S. glaucescens, S. tendae, S. nigra, S. albogriseolus, S. pilosus, S. rochei, S. bohaiensis and S. lonarensis. Streptomyces griseus, S. anulatus, S. microflavus and S. araujoniae separate in sub cluster 1A; Streptomyces griseus showed more close similarity with S. anulatus. Streptomyces covourensis, S. zhihengii, S. carpaticus, S. matensis, S. glaucescens, S. nigra, S. albogriseolus, and S. pilosus, were represented by single nodes which separate in different sub cluster. The larger cluster was represented by Streptomyces bohaiensis which separates in subcluster 1C, which is also represented by S. daghestanicus. Major cluster 2 is represented by the genus Nocardiopsis and it has been divided into two sub clusters, 2A and 2B. Sub cluster 2A presents all Nocardiopsis flavescens and single node Nocardiopsis listeria while sub cluster 2B represents all Nocardiopsis dassonvillei.

The phylogenetic tree presenting the relationship among the 45 strains of the genus Streptomyces is presented in Fig. 2. It showed the grouping of sequences into three distinct groups I, II, and III. Group I present a maximum of 17 Streptomyces strains; all three strains of S.araujoniae isolated from three different crop fields which showed 99 % sequence similarity formed a distinct branch in this group. Similarly, in this group S. griseus, S. anulatus, S. microflavus and S. roseofulvus forms separate cluster; these were isolated from different crop fields and showed more than 99 % sequence similarities. One strain of S. covourensis and S. zhihengii in cluster I were collected from the rice rhizosphere. Two strains of S. lonarensis separated in cluster II which showed 99–100 % similarity with respective species and were collected from rice and maize rhizosphere. Interestingly major cluster II comprises 15 strains separated into three subclusters, with a maximum of eight strains that belong to S. bohaiensis, followed by S. daghestanicus. Cluster III presents five species with single isolates of each which includes S. glaucescens, S. pilosus, S. nigra, S. albogriseolus and S. carpaticus; these strains were collected from rice, bulk soil, and grass field as presented in Table 1. Additionally, this cluster also presents 3 strains each of S. rochei and S. tendae; all these six strains were isolated from six different crop fields. Fig. 3 presents the relationship among the members of Nocardiopsis which exhibits the grouping of sequences in two major groups; cluster I comprise a maximum of 10 strains which showed 99–100 % sequence similarities with Nocardiopsis dassonvillei. Out of these 10 strains, seven were isolated from rice rhizosphere, two from coconut fields and one from sorghum rhizosphere. Further cluster II comprises eight strains that showed 99 % sequence similarities with Nocardiopsis flavescens these isolates were from six different crop fields which includes palm, okra, rice, redgram, lemon, and banana. Additionally in this cluster, 1 strain showed 99 % sequence similarities with Nocardiopsis listeri isolated from rice rhizosphere grouped as a separate subgroup.

Close

Fig. 2

Neighbour-joining phylogenetic tree based on 16S rRNA gene sequences showing the relationship among the 45 Streptomyces strains. Bootstrap value based on 1000 resampled datasets are shown at branch nodes.

Export to PPT

Close

Fig. 3

Neighbour-joining phylogenetic tree based on 16S rRNA gene sequences showing the relationship among the 20 Nocardiopsis strains. Bootstrap value based on 1000 resampled datasets are shown at branch nodes.

Export to PPT

3.5 Morphological characteristics of actinomycetes

The morphological properties of all 65 actinomycetes strains are presented in Supplementary Table 1. The strains showed differential growth patterns on different ISP media. Six strains viz., S. daghestanicus TN6, S. araujoniae TN14, N. flavescens TN14, S.bohaiensis TN17, S. griseus TN27 and N. dassonvillei TN33 were characterized as showing good growth in all the four ISP media. Twenty-one strains were characterized as showing good growth in atleast three ISP media while seventeen strains showed good growth in atleast two ISP media. Pigment production was observed in twenty strains in atleast one media. S. zhihengii TN 36 produced pigment on all four ISP media and S. araujoniae TN19 produced pigments on three ISP media while the strains S. araujoniae TN11, S. araunoniae TN14 and S. anulatus TN55 produced pigments on atleast two ISP media. The Media ISP-3 facilitated the production of pigment by 18 strains TN1, TN3, TN6, TN8, TN9, T11, TN13, TN14, TN16, TN17, TN19, TN28, TN31, TN35, TN38, TN55, TN63, and TN66; Six strains which include TN1, TN8, TN9, TN11, TN19, and TN28, exhibit pigment formation on ISP-1 media. Five strains showed pigmentation on ISP-4 media which includes TN4, TN5, TN9, TN14, and TN19 while ISP-7 facilitated pigment formation by only one strain (TN9). The colour of aerial and substrate mycelium of all the 65 actinomycetes strains was also recorded which includes white, brown, pale green, pale yellow, yellow, grey, greenish-yellow, light green, green, light yellow and dark green.

3.6 Antifungal activity of actinomycetes strains

Antifungal activities of all the 65 actinomycetes strains against four fungal strains, F. udum, F. oxysporum f.sp. ciceris, M. phaseolina and S. rolfsii. are represented in Table 3. All 65 strains showed antifungal activity against F. udum with inhibition ranging from 1.96 to 63.99 %. S. daghestanicus TN3, N. dassonvillei TN12 and S. araujoniae TN19 showed maximum inhibition with respective inhibition percentages of 63.99, 63.96 and 63.96. Twenty strains showed more than 50 % inhibition against F. udum. Similarly, all the strains exhibited antifungal activity against F. oxysporum f.sp. ciceris with inhibition ranging from 1.79 to 63.81 %. Nine strains showed more than 50 % inhibition against F. oxysporum while strains S. araujoniae TN11 and S. daghestanicus TN3 showed maximum inhibition with a percent inhibition of 63.81 and 61.33, respectively. Out of 65 strains, 48 showed the ability to inhibit Macrophomina phaseolina on plates with inhibitions ranging from 3.75 to 82.50 %. Twenty strains in the study have shown inhibition percent of 70 and above against M. phaseolina while strains S. rochei TN56, N. flavescens TN49 and S. daghestanicus TN 66 showed maximum inhibitions with percent inhibitions of 82.50, 81.67 and 79.17 respectively. Against S. rolfsii 39 strains showed inhibition and inhibition percent was recorded between 3.33 and 52.50. Only three strains viz., S. araujoniae TN11, S. araujoniae TN19 and S. griseus TN27 showed more than 40 % inhibition. A total of 27 strains showed antifungal activity against all four fungal strains, with six strains viz., S. pilosus TN4 (Fig. 4), S. tendae TN8, S. araujoniae TN11, N. dassonvillei TN12 S. araujoniae TN19 and S. griseus TN27 showing considerable percent inhibition against all the four pathogens tested, while 33 strain showed antifungal activity against atleast three fungal strains.

Close

Fig. 4

Antifungal activity of Streptomyces pilosus TN4 against different fungal pathogens; Macrophomina phaseolina (a), Fusarium oxysporum (b), Fusarium udum (c) and Sclerotium rolfsii (d).

Export to PPT

3.7 Nucleotide sequence accession numbers

The 16S rRNA gene sequences of 65 strains identified in the current study have been submitted to the GenBank nucleotide sequence database (https://www.ncbi.nlm.nih.gov/nucleotide). All the strains isolated and characterized in this study were submitted to NAIMCC (National Agriculturally Important Microbial Culture Collection, ICAR-NBAIM, India (Table 2).