2.1 Chemicals and reagents

Cell culture plates, ethidium bromide (EB), acridine orange (AO), propidium iodide (PI), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), dimethylsulfoxide (DMSO), 4,6-diamidino-2-phenylindole (DAPI), fetal bovine serum (FBS) and Roswell Park Memorial Institute 1640 medium (RPMI-1640) were obtained from Sigma-Aldrich, St. Louis, MO, USA. The Fast Lane Cell cDNA kit and QuantiFast SYBR Green PCR kits were procured from Qiagen, Hilden, Germany. From Promega, Madison, WI, USA, TUNEL examine kit was obtained. All other chemicals and reagents utilized in the current investigation were of molecular biology research ranking.

2.2 Allium porrum L: collection and preparation of organic solvent extract

Fresh Allium porrum L. whole plants were collected in September 2020, Riyadh, Saudi Arabia. Leek (Allium porrum) aerial parts were sieved, milled, and grounded using a commercial blender. 500 gm of fresh leek was soaked in 1500 mL of n-hexane for 72 h with frequent shaking using a shaker. Leek hexane extract was filtered, condensed using a rotary evaporator, weighed, and stored at −20 °C until further use. The residue was again soaked with 1500 mL of chloroform and methanol for 72 h, respectively, as sequential extraction. The n-hexane, ethyl acetate, and methanolic extract of leek were filtered and stored at −20 °C until further use.

2.3 Gas-chromatography and mass spectroscopy analysis

The identification of metabolites in n-hexane, chloroform, and methanolic extract of leek was carried out by GC/MS method. Briefly, GC–MS analysis was performed on a PerkinElmer Clarus 600 GC System, fitted with a Rtx-5MS capillary column (30 m × 0.25 mm inner diameter, × 0.25 μm film thickness; maximum temperature, 350 °C), coupled to a Perkin Elmer Clarus 600C MS. Ultra-high purity helium (99.99%) was used as carrier gas at a constant flow rate of 1.0 mL/min. The injection, transfer line and ion source temperatures were fixed as 290 °C. The ionizing energy was 70 eV. Electron multiplier voltage was obtained from autotune. The oven temperature was programmed and held at 60 °C for 2 min, then continued until 280 °C at a rate of 3 °C/min. The crude samples were diluted with an appropriate solvent (1/100, v/v) and filtered. Using 0.22 µm syringe filter, the leek extract(s) filtered and diluted with methanol were taken in a syringe and injected into the injector with a split ratio 30:1. All data were obtained by collecting the full-scan mass spectra within the scan range 40–550 amu. The percentage composition of the leek extract constituents were expressed as a percentage by peak area (PerkinElmer Clarus, 600 GC System).

2.4 Cell culture

The HT-115 (human colon carcinoma) cell line was procured from the ATCC, Manassas, VA 20110 USA. The obtained cells were grown in a 5% CO₂ (Thermo Scientific, USA) atmosphere at 37 °C with the supplementation of RPMI-1640 medium containing 10% FBS for regular subcultures and procedures to all additional experiments.

2.5 Assessment of in vitro cytotoxicity through MTT assay

In 96-well cell culture plates, HT-115 cells were plated at a concentration of 1 × 10⁴ cells/well. Cell were maintained for 24 h in a normal RPMI-1640 medium. Then, the cells were treated with various doses of leek hexane, chloroform, and methanol extracts (0, 0.1, 0.2, 0.4, 0.8, 1.2, and 2.4 µg/mL) for 24 and 48 h. After the incubation, 20 µL of MTT solution at a prescribed amount of 5 mg/mL (in PBS) was added to all wells. This incubation was continued for 4 h at 37 °C in the dark (Mosmann, 1983). The purple formazan created was suspended by adding 100 μL of DMSO. A plate reader from Bio-Rad (CA, USA) was used to measure the absorbance at 630 and 570 nm. The viability of HT-115 cells exposed to hexane, chloroform, and methanol leek extracts is presented as the proportion of live cells when compared with untreated cells (control cells), which was obtained using the following formula: [(Mean OD of control cells - Mean OD of different treated cells)/(Mean OD of control cells)] × 100. From the initial observation, we obtained the IC₅₀ of different leek extracts for 24 and 48 h. The IC₅₀ of leek methanol extract (LME) was found to be lower than those for hexane and chloroform extracts. From these observations, LME was selected to understand the probable mechanism of action on HT-115 cells. The cell viability experiments were repetitive of triplicates.

2.6 Morphological studies by fluorescence microscopy

Control and LME-treated cells were fixed with ice-cold ethanol. Necrotic cells and apoptotic cells were discriminated through PI and AO/EtBr staining. To calculate the level of necrotic cells, cells were treated and fixed as mentioned above and stained with PI (1 mg/mL). After the incubation of cells for 15 min in the dark, unbound PI was removed through three washes. From ten different fields, ∼300 PI-stained cells were scrutinized under an inverted fluorescence microscope (200× magnification). The PI-negative and positive cells were calculated by an individual blinded to the experimental set-up. The experiment was repeated four times in triplicate.

AO/EtBr staining was used to examine typical apoptotic morphological alterations and unusual chromatin associations (Leite et al., 1999). Viable and nonviable cells could be differentiated through AO/EtBr staining. In detail, experimental cells were exposed to different doses of LME (0, 0.1, 0.2, and 0.4 µg/mL) for 48 h in a 24-well plate. After the treatment period, cells were washed once with PBS and exposed to staining solution for 2 min (500 µL of AO/EtBr). After the cells were rinsed with PBS and immediately observed under an inverted fluorescent microscope fixed with excitation (530 nm), and emission (620 nm) filters and images of the samples were captured (200x magnification). In the same way, nuclear damage (condensed) was observed through staining the different experimental cells with an appropriate nuclear stain.

2.7 Analysis of oxidative stress, apoptosis, and tumor suppressor responsive genes through quantitative PCR

After the treatment period, RNA was isolated from control and LME-treated cells. After confirming the purity of RNA, the cDNA was prepared from treated cells by using the commercially available kit mentioned in the materials section. The manufacturer’s instructions were precisely followed to prepare cDNA. Gene expression levels of two major tumor suppressor genes, namely, Bcl-2 (forward-GTGGATGACTGAGTACCT; reverse - CCAGGAGAAATCAAACAGAG) and p53 (forward – CCTCAGCATCTTATCCGAGTGG; reverse - TGGATGGTGGTACAGTCAGAGC); and three major apoptotic genes, namely, Bax (forward- TCAGGATGCGTCCACCAAGAAG; reverse- TGTGTCCACGGCGGCAATCATC), caspase-3 (forward- CCAGGAGAAATCAAACAGAG; reverse- AAGGACTCAAATTCTGTTGCCACC), and caspase-9 (forward- GCTCTTCCTTTGTTCATC; reverse- CTCTTCCTCCACTGTTCA) were analyzed. To compare the expression of the different genes against their respective control expression, the expression of a reference gene, GAPDH, was also measured. The manufacturer's protocol was followed step by step to generate a qPCR reaction in a volume of 25 μL. The Ct data were utilized to assay the expression levels of LME-treated and control HT-115 cells. The differences in gene expression patterns were assayed as described previously (Yuan et al., 2006). The relative expression levels of the different genes were assayed using the following equation: 2^ΔΔCt (relative threshold) = ΔCt (experimental sample) × ΔCt (untreated control). Therefore, the different gene expression levels are presented as fold change compared with that of GAPDH. The calculated 2^−ΔΔCt values were used to plot the differentially expressed genes.

2.8 Quantification of different apoptotic protein expression by western blot analysis

After exposing the HT-115 cells to LME or leaving them untreated for 48 h, they were washed once with PBS. By adopting the previously published protocol, Western blot assay was executed (Naveen Kumar et al., 2015). Immediately thereafter, cells were lysed with RIPA buffer, including protease cocktail inhibitor (15 min on ice). At 4 °C, the lysates were centrifuged at 8000 rpm for 20 min and clear supernatant was collected. By using the Bradford method (Bradford, 1976), the protein concentration was quantified. A total of 25 µg of protein under each experimental condition was separated by 12% SDS-PAGE. A semi-dry transfer unit (Hofer TE77XP) was used to transfer the separated proteins to a PVDF membrane. After rinsing the membrane with PBS, the nonspecific sites were blocked with 2% BSA in 1 × TBST for 2 h at room temperature. After blocking, the membranes were washed twice with PBS to get off surplus 2% BSA. The blocked PVDF membrane was incubated with primary antibodies: p53 and active caspase-9 (from Santa Cruz Biotechnologies) and Bax, Bcl-2, and active caspase-3 (from Cell Signaling Technology). The primary antibodies were diluted to a 1:1000 ratio and hatched all night at 4 °C. After this incubation period, they were washed three times with TBST. Subsequently, for 2 h, they were incubated with appropriate secondary antibodies at room temperature. These secondary antibodies were either IgG-horseradish peroxidase rabbit antimouse or IgG-horseradish peroxidase goat anti-rabbit (1:20,000 dilution). The protein expression was observed through a chemiluminescence method. For equal loading of different samples, the same membrane was stripped and incubated with β-actin (Santa Cruz Biotechnology). Finally, Image J software was used to quantify the protein intensity.

2.9 Assay of lipid peroxidation and antioxidant levels

After treatment with LME, the cells were homogenized in Tris-HCl buffer (pH 7.0), and the cell lysate total protein was calculated by the Bradford protocol (1976). Lipid peroxidation was calculated using the thiobarbituric acid-reactive substances (TBARS), where malondialdehyde served as a standard (Ohkawa et al., 1979). The activity of antioxidant enzymes was measured by previously described methods SOD (Marklund and Marklund, 1974), GPx (Carlberg and Mannervik, 1975), and catalase (Sinha, 1972).

2.10 Intracellular assay of reactive oxygen species (ROS)

Intracellular ROS generation was assayed as reported previously (Alshammari and Balakrishnan, 2019). In detail, cells were loaded with 2′,7′-dichlorohydrofluorescein diacetate (DCFH-DA). This nonfluorescent cell-permeable composite undergoes hydrolysis via cellular esterases to deliver dihydro-2′,7′-dichlorofluorescein. The fluorescent 2′,7′-dichlorofluorescein (DCF) forms through the auto-oxidation of dihydro-2′,7′-dichlorofluorescein by H₂O₂ present inside the cells. The fluorescence level of DCF in the cell extract was quantified at an excitation wavelength of 485 nm and an emission wavelength of 530 nm. To obtain the absolute ROS produced intracellularly, the normal cells without DCFH-DA were maintained, the data from which were considered as the background fluorescence intensity, with the same being subtracted in all cases.

2.11 Statistical analysis

The SPSS/28.5 software package was used to statistically evaluate the grouped data. The data were analyzed through a one-way analysis of variance (ANOVA) followed by Tukey’s test. All data are presented as the mean ± SD. p ≤ 0.01 and p ≤ 0.001were considered statistically significant for all comparisons.

3.1 GC–MS based phytochemical profiling of leek methanol extract (LME)

In the present study, GC–MS analysis of LME has confirmed that the presence of major phytochemical components such as 74.42% peak area of 9, 12, 15 – Octadecatrienoic acid, 4.38% peak area of 9, 12 – Octadecadienoic acid, and 6% peak area of Cyclotrisiloxane group of compounds along with other 13 trace components. The results of GC–MS peak and list of components matched references with 90 % above in NIST01 & W8N08 library have been presented in the supplementary file (supplementary Fig. 1 and supplementary table 1).

3.2 In vitro cytotoxic effect of leek extracts on HT-115 cells

The effects of different leek extracts on the multiplication of human HT-115 cells are shown in Fig. 1. Concentration- and duration-dependent cytotoxic potentials of leek extract were observed in HT-115 cells vs. vehicle control (0 μg/mL). In the current investigation, significant inhibitory effects were noticed in the different leek extract cells. However, more inhibition was observed in LME-treated cells than for the hexane and chloroform extracts. Chloroform extract showed higher IC50 values (1.1 μg/mL at 24 h and 0.76 μg/mL at 48 h) than hexane (0.78 μg/mL at 24 h and 0.73 μg/mL at 48 h) and methanol extracts (0.4 μg/mL at 24 h and 0.2 μg/mL at 48 h). The IC₅₀ value for LME was found to be minimal [0.4 μg/mL at 24 h (Fig. 1A) and 0.2 μg/mL at 48 h (Fig. 1B)] when compared with those of the other extracts. These results show that LME has a greater antiproliferative effect than the other two extracts. We thus selected LME for use in the subsequent studies.

Close

Fig. 1

In vitro cytotoxic potential of hexane, chloroform, and methanol extracts of leek on HT-115 cells (Fig. 1a, 24 h; Fig. 1b, 48 h). The experiment was performed four times in triplicate. Outcome are articulated as mean ± S.D. (n = 6). *p ≤ 0.001 vs. control (0 μg is untreated control).

Export to PPT

3.3 Induction of apoptosis by LME in HT-115 cells

LME-treated cells were scrutinized under a light microscope (Fig. 2-i). The phase contrast images indicated the morphological changes in LME-treated cells when compared with untreated cells (control). The PI- and AO/EtBr-stained cells were observed under a fluorescent microscope. In this case, the LME-exposed cells showed the typical features of apoptosis mediated cell death. They featured an abnormal horseshoe-shaped nucleus, along with a fragmented nucleus and condensed chromatin. These features represent the apoptotic mode of cell death because they indicate golgi complex linearization and endoplasmic reticulum stress (Fig. 2-i, 2-ii, and 2-iii).

Close

Fig. 2

Cellular and nuclear damage analysis of LME in HT-115 cells using (2-i) light microscopy, (2-ii) propidium iodide staining, (2-iii) AO/EtBr staining and (2-iv) DAPI staining. a, control; b, 0.1 μg/mL LME; c, 0.2 μg/mL LME; d, 0.4 μg/mL LME. PI staining (200×) indicated abnormal nuclei, particularly featuring the disintegration of chromatin/nuclei and a horseshoe-shaped nucleus, which reflects cellular stress and cell apoptosis. Staining with AO/EtBr (200×) indicated the following findings were indicated by arrow heads: bright green, proapoptotic; light green, early apoptotic; orange, late apoptotic; and red, necrotic cells. In Fig. 2-iii, D indicates around 22% light green and orange staining pattern upon LME treatment representing early and late apoptotic cells. DAPI staining (200×) showed an abnormal and fragmented nucleus with bright florescence, which indicated nuclear damage and stress.

Export to PPT

AO/EtBr staining of the HT-115 cells exposed to 0.4 μg/mL LME showed that ∼22% of the cells were apoptotic and ∼5% were necrotic. When the LME concentration was increased, the number of apoptotic cells also increased (p ≤ 0.001). Similarly, when the duration of LME increased, the quantity of cells undergoing apoptosis is elevated [lower dose (p ≤ 0.001) of 0.2 μg/mL vs. higher dose of 0.4 μg/mL at 48 h]. To investigate the relationship between different doses and durations of LME exposure, we observed the following changes: dark green, pre-apoptosis; light green, early apoptosis; orange, late apoptosis; and red, necrosis (Fig. 2-iii).

Furthermore, to distinguish the LME-induced apoptosis in HT-115 cells, they were exposed to 0.1, 0.2, and 0.4 μg/mL LME (IC₅₀) for 48 h. Later than the treatment duration, cells were stained with the DNA binding dye DAPI (Fig. 2-iv) and observed by an individual blinded to the groups in this study. In the current investigation, no noteworthy cell death was identified at an LME concentration of 0.2 μg/mL (below). However, the IC₅₀ concentration (0.4 μg/mL) of LME produced apoptotic changes similar to nuclear pyknosis. Chromatin condensation and asymmetrical boundaries were observed around the nucleus at 48 h of treatment (Fig. 3). On the other hand, untreated cells emerged with round, clearly circumscribed, and homogeneously stained nuclei.

Close

Fig. 3

The percentage of apoptotic and necrotic cells in untreated control and LME-treated HT-115 cells, as revealed by the manual counting of propidium iodide staining. The experimentation was executed three times. Values are presented as mean ± S.D. (n = 4). * p ≤ 0.05 vs. control and^** p ≤ 0.001 vs. control.

Export to PPT

3.4 Effects of LME on mRNA expression levels of Bax, p53, Bcl-2, and caspases

We witnessed different expression patterns of apoptosis-associated genes in the untreated control, 0.2 and 0.4 μg/mL of LME (IC₅₀) treated HT-115 cells after 48 h. Significant changes in the mRNA levels of Bax, Bcl-2, caspase-3, and caspase-9 were observed in the LME-treated and control HT-115 cells (Fig. 4). Twofold increase were found in the mRNA contents of Bax and caspase-3, while there was also a significant reduction (p ≤ 0.001) in the level of Bcl-2 expression in HT-115 cells exposed to 0.4 μg/mL LME compared with the level in healthy control HT-115 cells. The level of a key tumor suppressor gene, p53 was upregulated in the cells after suppressing mdm2. Approximately twofold elevation in the p53 expression level (p ≤ 0.001) was observed in 0.4 μg/mL LME-treated cells compared with the level of untreated cells.

Close

Fig. 4

The mRNA expression levels of tumor suppressor and apoptosis related genes in control and LME-treated HT-115 cells after 48 h. Values are presented as mean ± S.D. (n = 4). *p ≤ 0.05 vs. control and ^**p ≤ 0.001 vs. control.

Export to PPT

3.5 Protein expression of Bax, p53, Bcl-2, and caspases in LME-treated HT-115 cells

The protein contents of the apoptotic indicators p53, Bax, caspase-3, and caspase-9 and the anti-apoptotic marker Bcl-2 were assayed. As shown in Fig. 5, we observed a twofold increase of Bax and fourfold increases of p53, caspase-3, and caspase-9 proteins (p ≤ 0.05). In calculation, there was a significant (p ≤ 0.05) decrease in the Bcl-2 protein intensity with 0.4 μg/mL LME compared with that of control cells. The increases in the levels of apoptotic proteins appeared in a concentration-dependent mode for Bax, p53, caspase-3, and caspase-9, with the findings being significantly (p ≤ 0.001) lower even at 0.2 μg/mL LME when compared with 0.4 μg/mL LME at 48 h.

Close

Fig. 5

Western blot result for tumor suppressor and apoptotic pathways related protein levels of control and LME-treated HT-115 cells for 48 h. Values are presented as mean ± S.D. (n = 4). * p ≤ 0.05 vs. control and ^** p ≤ 0.001 vs. control.

Export to PPT

3.6 Lipid peroxidation and antioxidant status in LME-treated HT-115 cells

The levels of lipid peroxidation (LPO) and antioxidant activities of CAT, SOD, and GPx and the non-enzymatic antioxidant GSH were measured in LME-treated and untreated HT-115 cell lysates (Fig. 6). LPO was significantly elevated (p ≤ 0.001) in the cells exposed to 0.4 μg/mL LME, when compared with that of untreated cells (control). The levels of antioxidants such as SOD and GPx and non-enzymatic antioxidants such as GSH were significantly decreased (p ≤ 0.001) in cells exposed to 0.2 μg/mL LME, compared with the levels of untreated control HT-115 cells. More significant reductions were observed in cells exposed to 0.4 μg/mL LME than in control cells. Surprisingly, CAT activity did not show any statistically significant difference between LME and control HT-115 cells. The increase in lipid peroxidation and decreased antioxidant activities appeared in dose-dependent manners, except for the case of CAT. The lower dose (0.2 μg/mL) used in this study showed a significant difference in antioxidant changes than the higher concentration (0.4 μg/mL) at 48 h.

Close

Fig. 6

Lipid peroxidation, GSH level and antioxidant (catalase, GPx, SOD) enzymes activities in control and LME-treated human HT-115 colon cancer cells for 48 h. Values are presented as the mean ± S.D. (n = 5). *p ≤ 0.05 vs. control and ^**p ≤ 0.001 vs. control.

Export to PPT

3.7 ROS in control and LME-treated HT-115 cells

As we observed significant differences in antioxidant status in untreated (control) and LME-treated cells (Fig. 7), we tested whether these differences in antioxidant status are due to the elevation of intracellular ROS in LME-treated cells. The change in ROS level was statistically significant even in the cells exposed to a low dose of LME. The levels were increased further in the cells treated with a higher dose of LME. These findings clearly show that LME could prohibit the multiplication of cancer cells through the elevation of intracellular ROS.

Close

Fig. 7

Level of intracellular reactive oxygen species in control (A) and LME-treated (B, 0.2 μg/mL & C, 0.4 μg/mL) human HT-115 colon cancer cells for 48 h. Outcomes are presented as mean ± S.D (n = 4). *p ≤ 0.05 vs. control and ^** p ≤ 0.001 vs. control.

Export to PPT