Exogenous methyl jasmonate (MeJA) altered phytochemical composition and enhanced the expression of PatAACT gene of in vitro culture-derived patchouli var. Sidikalang (Pogostemon cablin Benth.)

2.1 Establishment of culture medium and in vitro inoculation of plant explants

Pogostemon cablin var. Sidikalang was obtained from the Indonesian Sweetener and Fiber Crops Research Institute, and nodal segments of the plant were used as explants. The explants underwent surface sterilization and were initially inoculated in the MS medium. Subsequently, the resulting plantlets were used as secondary explant sources for this present study.

The solid MS culture medium was prepared by mixing 4.4 g/L MS media (PhytoTech Lab®, USA), 30 g/L of sucrose (Duchefa Biochemie, Netherland), and solidifying the medium with 8 g/L of gelrite powder (PhytoTech Lab®, USA). A series of combined BAP (0; 1.25; 2.5 μM) and NAA (0; 0.25; 0.5 μM) concentrations were applied to the MS medium. The combination of both BAP (S) and NAA (A) were coded as: S1A1, 0 μM of BAP and 0 μM of NAA; S1A2, 0 μM of BAP and 0.25 μM of NAA; S1A3, 0 μM of BAP and 0.5 μM of NAA; S2A1, 1.25 μM of BAP and 0 μM of NAA; S2A2, 1.25 μM of BAP and 0.25 μM of NAA, S2A3, 1.25 μM of BAP and 0.5 μM of NAA; S3A1, 2.5 μM of BAP and 0 μM of NAA; S3A2, 2.5 μM of BAP and 0.25 μM of NAA; S3A3, 2.5 μM of BAP and 0.5 μM of NAA. Finally, the axenic secondary explant derived from nodal segment were inoculated in the culture medium and cultured at room culture at ± 25⁰ C with 16 h light of photoperiod for 50 days. Each treatment consisted of three replications.

2.2 Plant growth measurement and data analysis

The growth response was determined based on shoot formation and callogenic frequency according to Jadid et al. (2024). The equations used in this study are as follows:

2.3 Methyl jasmonate treatment and patchouli biomass measurement

The application of MeJA (Sigma-Aldrich, USA) was carried out using the hydroponic system (Deschamps and Simon, 2006). Hydroponic solution was prepared using 12.5 % MS basal medium. MeJA was dissolved using ethanol (Merck, Germany) and diluted with distilled water to make 100 and 300 µM solutions. Planlets were firstly grown in greenhouse for two weeks before being transferred to hydroponic media supplemented with MeJA for up to seven days. Measurement of patchouli plant biomass is carried out before and after being treated with MeJA. Then, the measurement data was analyzed using the Paired T-test (Minitab 19).

2.4 Patchouli oil extraction using sonication

600 mg of patchouli leaf samples were submerged in liquid nitrogen for 5 min, then crushed with a mortar to obtain sample powder. The powder was mixed with 3 mL of ethyl acetate (Merck, Germany), followed by sonication for 20 min (Fisher Scientific FB 15051). The extract was filtered using WhatmanTM filter paper (Sigma Aldrich, USA) and then collected. It was subsequently centrifuged at 6000 rpm (Thermo Scientific MySPIN 6) for 5 min at ambient temperature. The supernatant was taken and then added with anhydrous sodium sulfate solid (Merck, Germany). The clear greenish extract was collected in a glass bottle for further analysis using Gas Chromatography Mass Spectrometry (GC/MS) (Shimadzu QP2010-Plus) (Yadav et al., 2017).

2.5 Qualitative analysis of the extract using gas chromatography-mass spectroscopy

Patchouli oil was analyzed using GCMS 2010 system (Shimadzu QP2010-Plus) with an RTx- 5MS column (30 m × 0.25 mm × 0.25 µm). The condition used inlcude: injector temperature at 200 °C, helium as carrier gas, injection vol. 0.2 µL with an injection split of 1:200, at 60.5 kPa, flow rate of 13.9 mL/min, flow rate of 0.99 mL/min, linear velocity of 36.5 cm/sec and a purge flow rate of 3 mL/min. The initial temperature of the column oven was at 70 °C, then augmented by 15 °C/min to 100 °C, with 2 min hold time, followed by a 2 °C/min increase to 160 °C, with 2 min hold time, and finally ramped up by 20 °C/min to 250 °C with a 6 min hold time, resulting in a total program time is 46.5 min. The MS specifications include the ion source temperature at 200 °C, interphase temperature at 250 °C, and detector voltage at 0.70 kV; with a 0.5 s duration and a mass range of 40–550 m/z. Fragment ions (m/z SIM) utilized were 95, 124, 161 and 222 (Yadav et al., 2017).

2.6 Extraction of total RNA and gene expression analysis

Patchouli leaves were collected after seven days of MeJA treatment. The total RNA extraction was performed according to Jadid et al. (2016) and was quantified using Nano Drop (Thermo Scientific™ NanoDrop 2000, USA) (Jadid et al., 2018b). RT-qPCR was carried out utilizing 2x-SensiFAST™ SYBR-No-ROX One-Step Mix (Meridian Bioscience, USA). We measured the expression of PatAACT using the following primers: PatAACT-F (5′- TGTGCCTCTGGAATGAAAGCA–3′) and PatAACT-R (5′– CAGCATTCCATCAACCAGCG – 3′). The reference gene used in this study was P. cablin Actin gene ACT-Forward (5′ − CGACTC TGGTGATGGTGTCAG – 3′) and ACT-Reverse (5′ – CGAGAGCAATGTAGGCTAGC–3′). The reaction of RT-qPCR conditions was: 10 min for reverse transcription at 45 °C, followed by 2 min of polymerase activation at 95 °C. Finally, about 39 cycles of PCR were performed at 95 °C (5 s); 61.3 °C (10 s) and 72 °C (20 s) for denaturation, annealing and elongation, respectively. All samples were in triplicate and analyzed according to 2^-ΔΔCq method.

3.1 Impact of combined BAP and NAA on organogenesis and callogenesis responses

Different combination of BAP and NAA exhibited distinct shoot and root formation responses after 50 days of incubation. Low percentage of explants (0 to 80 %) forming roots was detected in almost all treatments (Table 1). We noted that axenic nodal explants placed in S2A1 and S3A3 treatments were not able to produce root (Fig. 1C-D). The highest percentage of rooted explants (80 %) was shown by treatment S1A2 (BAP 0 μM + NAA 0.25 μM) followed by S1A1 treatment (60 %) (Fig. 1A-B). Meanwhile, all treatments were able to induce shoot formation (varied from 50 to 100 %). The lowest shoot induction respon was demonstrated in S2A2 treatment. All nodal segment explants also exhibited callus formation. The presence of BAP in the culture medium with or without NAA apparently favored callus formation (Table 1). In contrast, zero supplementation of BAP resulted in low frequency of callus formation, which ranged from 20 to 80 %.

Close

Fig. 1

Effect of combined BAP and NAA on organogenesis and callogenesis after 50 days of incoulation. A: S1A1; B: S1A2; C: S3A3; D: S2A1; E: S3A2; F: S1A3. 1: root; 2: callus; 3: adventitious shoots. (Scale bar = 1 cm). Abbreviations: BAP, 6-benzyl amino purine; NAA, naphtaleneacetic acid; S1A1 (control), 0 μM of BAP and 0 μM of NAA; S1A2, 0 μM of BAP and 0.25 μM of NAA; S3A3, 2.5 μM of BAP and 0.5 μM of NAA; S2A1, 1.25 μM of BAP and 0 μM of NAA; S3A2, 2.5 μM of BAP and 0.25 μM of NAA; S1A3, 0 μM of BAP and 0.5 μM of NAA.

Export to PPT

3.2 Effect of BAP and NAA combination on root, shoot and leaves proliferation

Combination of BAP and NAA siginificantly influenced roots, shoots, and leaves proliferation on P. cablin in vitro culture (p-values < 0.05) (Table 2). Highest number of root (6.3 roots per explants) were observed in S1A2 treatment, followed by treatment with 1.25 μM of BAP and 0.25 μM of NAA (S2A2) (3.7 roots per explants). These results suggest that 0.25 μM of NAA is required to induce P. cablin root proliferation in vitro. Meanwhile, high level of NAA (0.5 μM) concentration inhibited root proliferation (Table 2). We noted that three treatments resulted in zero root proliferation. They include the S1A3 treatment (0 μM BAP + 0.5 μM NAA), S2A1 (1.25 μM BAP + 0 μM NAA) and S3A3 (2.5 μM BAP + 0.5 μM NAA).

All treatments induced shoot proliferation, which varied between 2.0 and 7.0 shoots per explants. Our results showed the highest average number of shoots (7.0 shoots per explants) in the S3A2 treatment (2.5 μM BAP + 0.25 μM NAA). Meanwhile, the lowest average of shoot number (2.0 shoots per explants) was obtained in three treatments, including S1A1 (0 μM BAP + 0 μM NAA), S1A2 (0 μM BAP + 0.25 μM NAA) and S3A1 (2.5 μM BAP + 0 μM NAA). Our results also demonstrate that shoot proliferation requires higher cytokinin (BAP) concentration than auxin (NAA).

BAP and NAA treatments also affected in vitro patchouli leaves production (p-values < 0.05). The production of patchouli leaves was consistent with shoot proliferation. The number of leaves ranged from 10.3 to 42.5 leaves per explants (Table 2). Highest number of leaves was obtained from S3A2 (BAP 2.5 μM + NAA 0.25 μM) (Fig. 2). Meanwhile, treatment S1A1 demonstrated the lowest number of leaves (10.3 leaves per explants). Furthermore, we highlighted that higher amount of BAP concentration, compared to NAA, is responsible for the formation and proliferation of patchouli leaves.

Close

Fig. 2

Effect of combined BAP and NAA on leaf formation after 50 days of incoulation. A: S1A1 (control); B: S1A2; C: S2A2; D: S3A2. 1: leaf. (Scale bar = 1 cm). Abbreviations: BAP, 6-benzyl amino purine; NAA, naphtaleneacetic acid; S1A1 (control), 0 μM of BAP and 0 μM of NAA; S1A2, 0 μM of BAP and 0.25 μM of NAA; S2A2, 1.25 μM of BAP and 0.25 μM of NAA, S3A2, 2.5 μM of BAP and 0.25 μM of NAA.

Export to PPT

3.3 Short term exogenous MeJA treatment did not affect the growth of patchouli derived from in vitro culture

Patchouli plant obtained from in vitro culture were then moved to the greenhouse and grown in polybag for two weeks before being placed into the hydroponic container containing 12.5 % MS medium with 0 μM, 100 μM and 300 μM of MeJA. The fresh weight of the patcouli plants was measured before and after MeJA treatment. Our results demonstrated that MeJA did not statistically affect fresh weight of the patchouli plants (Fig. 3). Slight reduction of fresh weight was observed in patchouli plants treated with 0 μM and 300 μM of MeJA. In addition, plants treated with 100 μM of MeJA demonstrated more reduction (20.7 %) in fresh weight compared to other treatments (Fig. 3).

Close

Fig. 3

Effect of Methyl Jasmonate (MeJA) treatment on the fresh weight of patchouli plants. Blue and red histograms represent fresh weight of patchouli plants before and after MeJA treatments, respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Export to PPT

3.4 Effect of MeJA on phytochemical composition of p. Cablin var. Sidikalang

Following the MeJA treatment, leaves of the treated P. cablin plants were subjected to phytochemical composition analysis using GC–MS. We obtained 50 compounds detected during analysis (Suppl. 1). Nevertheless, among those compounds, 16 metabolites were similarly found in all treatments with distinct percentage of areas (Table 3). It indicated different concentration of each metabolite. We noted that 1,2,3,3-D4-Trans-1,2-Dihydroxy-Cyclopentane covered around 63.55 % of peak area in 0 μM of MeJa, followed by 100 μM and 300 μM of MeJA representing 67.73 % and 64.19 % of peak areas, respectively. Other metabolites found in high percentage of areas were 1,3,5-Cycloheptatriene and 2H-Pyran-2-one, 3-acetyl-4-hydroxy-6-methyl-. Meanwhile, lowest percentage of area covered in the chromatogram (Suppl. 2). We also identified patchouli alcohol in all MeJA treatments (0; 100 and 300 μM) (Table 3). This compound signifies the presence of patchouli oils in the leaves extract of patchouli plants treated with MeJA.

Our analysis also discovered 18 natural compounds found exclusively in patchouli plants with no MeJA treatment (Table 4). In the 0 μM MeJA treatment, the compounds with the largest peak areas were 1-trimethylsilyloxy-2-(3′-methoxy-4′-trimethylsilyloxyphenyl) ethane (0.41 %), 2,2,3-Trimethyloxirane (0.30 %), and N-(1-benzofuran-5-yl) acetamide (0.32 %). Conversely, tetradecane had the smallest peak area at 0.04 %. Overall, these compounds (Table 4) were detected between retention times of 3.23 and 46.04 min (Suppl. 2).

We discovered 26 compounds that were found only in patchouli plants treated with 100 µM of MeJA (Table 5). The retention time of these metabolites ranged from 2.32 to 45.18 min (Suppl. 2). The compounds with the highest peak area in the 100 µM MeJA treatment were Formic acid, butyl ester (3.42 %), Butanal, 3-hydroxy (0.54 %) and Pentanal, 3-(acetyloxy)-2,2,4-trimethyl- (0.45 %). While the compounds with the lowest peak area are Trans-Caryophyllene (0.06 %), Propanal, 3- hexylimino-2-nitro- (0.06 %) and Pentanal (0.06 %).

Another 21 compounds were obtained exclusively from patchouli treated with 300 µM (Table 6). Their retention time ranged from 2.30 to 46.03 min (Suppl. 2). The compounds with the highest area in the 300 µM MeJA treatment were Acetic acid, butyl ester (3.79 %), Cyclopentene, 1-ethenyl-3-methylene (1.77 %) and Xylopyranoside, methyl 4-azido-4-deoxy-,β.-L- (0.71 %). While the compounds with the lowest area were Cyclooctene, 3- methyl- (0.05 %) and 1,2-Ethanediamine, N,N'-bis(2-aminoethyl)- (0.05 %) (Table 6). These overall results suggest that short term exogenous treatment of methyl jasmonate might alter phytochemical composition of patchouli var. Sidikalang.

3.5 Short term of exogenous methyl jasmonate treatment enhanced the expression of Acetyl-CoA acyltransferase (AACT) gene

The PatAACT gene expression of P. cablin treated plants was analyzed using qRT-PCR. Our results showed that 100 µM and 300 µM of MeJA treatments greatly increased the expression of the PatAACT gene (Fig. 4). 100 µM of MeJA was able to induce the expression of PatAACT 7.42 folds compared to untreated plants. While the PatAACT gene expression was also increased by 2.9 folds after 300 µM of MeJA treatment, compared to control plants.

Close

Fig. 4

The PatAACT gene expression of Pogostemon cablin after short-term treatment using methyl jasmonate (MeJA) and Biosynthetic pathway of patchoulol (adapted from Tang et al., 2019). Abbreviations: MVA, mevalonate; MEP, methylerythritol-4-phosphate; AACT, acetoacetyl-CoA thiolase; HMGS, 3-hydroxy-3-methylglutaryl-CoA synthase; HMGR, 3-hydroxy-3-methylglutaryl-CoA reductase; MVK, mevalonate kinase; PMK, 5-phosphomevalonate kinase; MVD, 5-diphosphomevalonate decarboxylase; IDI, isopentenyl diphosphate-dimethylallyl diphosphate isomerase; FPPS, farnesyl diphosphate synthase; DXS, 1-deoxy-D-xylulose-5-phosphate synthase; DXR, 1-deoxy- D-xylulose-5-phosphate reductoisomerase; MCT, 2-C-methyl- D-erythritol-4-phosphate cytidyl transferase; CMK, 4-(cytidine 50 −diphospho)-2-C-methyl-D −erythritol kinase; MDS, 2-C-methyl-D −erythritol-2,4-cyclodiphosphate synthase; HDS, −hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase; HDR, −hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate reductase; GPPS, geranyl diphosphate synthase.

Export to PPT