Isolation and identification of Leptospira species from bovines by rpoB and LipL41 genes based phylogenetic analysis

2.1 Polymerase chain reaction (PCR)

DNA extraction: The DNA extraction from the suspected materials was carried out using QIAmp DNA mini kit – (Qiagen, Cat. No: 51306) following the manufacturer’s instructions.

Primers: The following sets of primers were used for the gene G1 F – 5′ CTG AAT CGC TGT ATA AAA GT 3′ and G2 R – 5′ GGA AAA CAA ATG GTC GGA AG-3′ [4]. LipL32-F 5′ CATATGGGTCTGCCAAGCCTAAA 3′ and LipL32-R 5′ CTCGAGTTACTTAGTCGCGTCAGAA 3′ [3]. The PCR reaction was done in 25 ul as previously described (Bal et al., 1994; Meenambigai et al., 2011). The PCR was performed in the total volume of 25 µl reaction mixture as follows:

Master Mix12.5 μl, Forward Primer (10 pmole/μl) 1.0 μl, Reverse Primer (10 pmole /μl) 1.0 μl, Template DNA 4.0 μl, Nuclease free water 6.5 μl, Total 25.0 μl, For positive control four µl of DNA template (L. interogans serovar Hardjo) and for Negative control known negative DNA (Staphylococcus species) was used.

For secY PCR, using primer G1 and G2, one cycle of 94 °C for 5 min for initial denaturation followed by 32 cycles of 94 °C for 1 min-denaturation, 55 °C for 1 min- Annealing, 72 °C for 2 min for extension and final extension of one additional cycle of 72 °C for 6 min.

Agarose gel electrophoresis:

Following electrophoresis, the gel was visualized at 300 nm wave length using a UV transilluminator for the presence of specific amplicons along with DNA molecular weight marker.

2.2 Phylogenetic analysis

The PCR positive samples and the isolates were amplified for sequencing and subsequent phylogenetic analysis using partial rpoB and LipL41 gene sequences using the primers rpoB-F: 5′CCTCATGGGTTCCAACATGCA 3′ and rpoB-R :5′CGCATCCTCRAAGTTGTAWCCTT 3′ and LipL41-F 5′ TAGGAAATTGCGCAGCTACA 3′ and LipL41-R: 5′GCATCGAGAGGAATTAACATCA 3′ and PCR conditions as described earlier (Balamurugan et al., 2013; Bal et al., 1994; Ahmed et al., 2006) along with positive and negative controls. For partial rpoB first cycle of 94 °C for 3 min for initial denaturation, followed by 39 cycles of 94 °C for 90 sec denaturation, 55 °C for 1 min Annealing, 72 °C for 45 sec for extension and final extension of final extension of 72 °C for 20 min. Similarly, for LipL41, first cycle 95 °C for 5 min for initial denaturation and then 34 cycles of 94 °C for 30 sec denaturation, 58 °C for 30 sec Annealing, 72 °C for 1 min for extension and final extension of one cycle of 72 °C for 6 min.

The amplicons were commercially sequences and edited nts sequences by mMEGA 5 software was analyzed by BLAST and Clustal W methodology using the published sequences (Tables 1 and 2).

3.1 Isolation of leptospires in EMJH medium

The different samples collected from the MAT positive animals were subjected for isolation, out of which three samples (1.84%) yielded growth of leptospires (Fig. 1) during the second week of incubation. Eventhough, 12 samples were positive by PCR , we could isolate leptospires only from three samples (25%) indicating that less sensitivity of the isolation method or it may be due to the contamination of the other organism while employing the isolation. However, inspite of repeated sub culture and following strict biosecurity and sterility measures the growth was observed in only three samples.

Close

Fig. 1

Growth of leptospires in EMJH liquid (a) growth &control and EMJH semisolid medium (b) control &growth.

Export to PPT

3.2 Polymerase Chain reaction (PCR)

The different samples collected from MAT positive animals were initially screened using G1 and G2 primers (Gravekamp et al., 1993) could detect 12 (7.36%) leptospiral DNA with an amplicon size of 285 bp. Subsequently, when all the samples were subjected to LipL32 specific PCR the same 12 samples were found positive with an amplicon size of 756 bp (Figs. 2 and 3). The identification of Leptospira is a fool-proof mechanism to determine the active infection in any given animal, hence genomic detection by PCR was employed to confirm the disease in the seropositive animals as PCR being more specific, rapid, less cumbersome. The detection of same 12 samples as positive by both primer sets has shown the efficacy of both the primer sets and the results were in agreement (Cheema et al., 2007), as they also reported that the above primers were similar in their efficacy for diagnosis of leptospirosis. Further, it was found that all the 12 samples were positive by both primers indicating the absence of Grippotyphosa serogroup/serovar. Moreover, all the PCR positive cases were from the animals with aborted history especially from various tissues of the aborted foetus has resulted in specific amplicons. This finding clearly indicates that targeting more aborted animals with repeated collections could help in finding more positive cases by PCR.

Close

Fig. 2

Agarose gel showing PCR amplifications with G1G2 Primers. Lane M: 100 bp ladder; Lane 1: Positive control (Reference sejroe strain); Lane 2: Negative control (Staphylococcus Spp); Lane 3: No template control; Lane 4: Positive isolate (KVAFSU_BANG_KAR I); Lane 5: Positive isolate (KVAFSU_BANG_KAR II); Lane 6: Negative sample.

Export to PPT

Close

Fig. 3

Agarose gel showing PCR amplifications with LipL32 Primers. Lane M: 100 bp ladder; Lane 1: Positive sample (KVAFSU_BANG_KAR 1); Lane 2: Positive isolate (KVAFSU_BANG_KAR I); Lane 3: Positive control (Reference sejroe strain); Lane 4: Negative control (Staphylococcus Spp); Lane 5: Negative template control; Lane 6: Negative sample.

Export to PPT

3.3 Nucleotide sequencing of PCR products

Direct sequencing of the purified PCR amplified partial rpoB and LipL41 gene products (Figs. 4, 5) was done using the gene specific primer pairs. The partial rpoB gene primer included Lept 1900F and Lept 2500R bordering a hypervariable region between the position 1900 and 2500. The LipL41 gene primer included the polymorphic sequence size of 518 coating for outer membrane lipoprotein with a PCR product size of 520 bp (Ahmed et al., 2006). There is an exponentially high sequencing data of biological genomes is available now for molecular biological or genetic investigations (Bansal, 2005). The genetic analysis of leptospires is to be established to show the genetic relatedness and evolutionary variation among the different Leptospira species prevalent in a geographical area. The study of nucleotide sequence is important to understand the evolution of new types or species, its importance in the development of diagnostic and molecular epidemiological investigations. Further, this technique is beneficial in identification of even single nucleotide deletion / addition or substitution, which cannot be detected in any other methods.

Close

Fig. 4

Agarose gel showing PCR amplification with rpoB Primers. Lane M: 100 bp ladder; Lane 1: Positive isolate (KVAFSU_BANG_KAR I); Lane 2: Positive isolate (KVAFSU_BANG_KAR II); Lane 3: Positive isolate (KVAFSU_BANG_KAR III); Lane 4: Negative control (Staphylococcus Spp); Lane 5: Positive control (Reference canicola strain); Lane 6: No template control; Lane 7: Negative sample.

Export to PPT

Close

Fig. 5

Agarose gel showing PCR amplification with LipL41 Primers Lane M:100 bp ladder; Lane 1: Positive isolate (KVAFSU_BANG_KAR I); Lane 2: Positive isolate (KVAFSU_BANG_KAR II); Lane 3: Positive control (Reference canicola strain); Lane 4: Negative control (Staphylococcus Spp); Lane 5: No template control; Lane 6 and 7: Negative sample.

Export to PPT

In principle, the phylogenetic analysis based on alignment of nucleotide sequence of specific genes provide an insight into the genetic makeup of the leptospires and their sharing with the other members of the group. This approach is perhaps the most realistic and presents a quick bird’s eye view of the complex inter-relatedness.

3.4 Phylogenetic analysis

The Phylogenetic trees were constructed and the evolutionary history was inferred using the Neighbour-Joining method (Saitou and Nei, 1997) using corresponding sequences from both published reference rpoB and LipL41 sequences from different parts of the world and nucleotide sequences obtained in this study. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) were shown next to the branches (Felsenstein, 1985). The evolutionary distances were computed using the Neighbour-Joining tree method (Tamura et al., 2004) and are in the units of the number of base substitutions per site. The analysis involved nucleotide sequences from reference strains as well as amplified products sequenced in this study. Evolutionary analyses were conducted in MEGA5 (Tamura et al., 2007) The details are shown as per the cluster formation in (Figs. 6, 7).

Close

Fig. 6

Phylogenetic tree of partial rpoB gene nucleotide sequences using neighbour-joining method.

Export to PPT

Close

Fig. 7

Phylogenetic tree of LipL41 gene nucleotide sequences of Leptospira constructed based on neighbour-joining method.

Export to PPT