10.2
CiteScore
3.6
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
ABUNDANCE ESTIMATION IN AN ARID ENVIRONMENT
Authors’ Response
Case Report
Case Study
Correspondence
Corrigendum
Editorial
Full Length Article
Guest Editorial
Invited review
Letter to Editor
Letter to the Editor
Original Article
Research Article
Retraction notice
REVIEW
Review Article
SHORT COMMUNICATION
Short review
7.2
CiteScore
3.7
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
ABUNDANCE ESTIMATION IN AN ARID ENVIRONMENT
Authors’ Response
Case Report
Case Study
Correspondence
Corrigendum
Editorial
Full Length Article
Guest Editorial
Invited review
Letter to Editor
Letter to the Editor
Original Article
Research Article
Retraction notice
REVIEW
Review Article
SHORT COMMUNICATION
Short review
View/Download PDF

Translate this page into:

Original article
31 (
4
); 648-652
doi:
10.1016/j.jksus.2018.03.009

Uropathogenic Escherichia coli (UPEC) in Jordan: Prevalence of urovirulence genes and antibiotic resistance

Department of Medical Laboratory Sciences, Jordan University of Science and Technology, Irbid 22110, Jordan

⁎Corresponding author at: Department of Medical Laboratory Sciences, Faculty of Applied Medical Sciences, Jordan University of Science and Technology, Irbid 22110, Jordan. mkshakhatreh@just.edu.jo (Muhamad Ali K. Shakhatreh),

Disclaimer:
This article was originally published by Elsevier and was migrated to Scientific Scholar after the change of Publisher.

Peer review under responsibility of King Saud University.

Abstract

This study examined the prevalence of urovirulence genes in Uropathogenic Escherichia coli (UPEC) isolates obtained from Jordanian patients. In addition, antibiotic susceptibility profile of the isolates was also examined.

Isolates (n = 227) were subjected to PCR detection of vat, fyuA, chuA, yfcV, sivH, shiA, sisA, sisB and eco274 genes. The UPEC virulence genes prevalence rates were shiA (92%), sisA (72%), eco274 (44%), sivH (36%), vat (27%), yfcV (25%), sisB (25%), chuA (20%), and fyuA (18%). Approximately half and 82% of the isolates produced extended-spectrum beta-lactamases (ESBL) and were resistant to three or more antimicrobial classes, respectively. Among the isolates, highest resistance was for augmentin (83%) and nalidixic acid (78%). Modest resistance was for cefoxitin (21%) and cefixime (20%). Low resistance was for norfloxacin (5%), amikacin (3%), and ertapenem (0.4%).

In conclusion, The UPEC virulence genes shiA and sisA are highly prevalent among the isolates. In addition, high resistance of UPEC to augmentin and nalidixic acid was reported. This may help in elucidating UPEC pathogenesis, and facilitate better treatment strategies for urinary tract infection patients.

Keywords

Escherichia coli
UPEC
Urovirulence genes
Urinary tract infections
Antimicrobial agent resistance
1

1 Introduction

Urinary tract infections (UTIs) frequently occur in humans. The uropathogenic Escherichia coli (UPEC) is significantly associated with etiologies of UTIs, including pyelonephritis and cystitis (Hannan et al., 2012). UPEC has many virulence factors that assist its colonization, invasion, and survival within the host urinary system (Behzadi et al., 2016; Bien et al., 2012; Mao et al., 2012). These factors include adhesins, siderophores, toxins, capsule production, and proteases. In addition, several autotransporter (AT) proteins, which are typically associated with phylogeny (Zude et al., 2014), are correlated with virulence and have been identified in UPEC (Restieri et al., 2007; Zalewska-Piatek et al., 2015). It is believed that AT proteins have structural features that permit their pass through biological membrane systems (Allsopp et al., 2010), in addition to adhesion, invasion, and biofilm formation during pathogenesis (Allsopp et al., 2012, 2010). Among the AT proteins is the serine protease toxin (vat), which is encoded by vat, and that is found in both UPEC and avian pathogenic Escherichia coli (APEC) isolates (Rossiter et al., 2015; Zhuge et al., 2013). FyuA encoding for a heme binding protein called yersiniabactin receptor, and yfcV encoding for one of the chaperone-usher fimbriae subunits that are associated with UPEC (Spurbeck et al., 2012). UPEC chuA gene is also encodes a heme binding protein that mediates heme uptake and transport an plays a role in UTIs (Torres et al., 2001).

The products of shiA, sisA and sisB, are involved in the pathogenesis of UPEC by down-regulating the innate inflammatory response during infection (Lloyd et al., 2009b; Mao et al., 2012). On the other hand, products of eco274 and sivH, only demonstrated a correlation with UTIs, but their roles in pathogenesis remain undefined. (Cusumano et al., 2010; Lloyd et al., 2009a).

While E. coli archetypal UPEC virulence genes (papG, cnfI, hlyA, iroN, and usp) have been extensively studied (Farshad et al., 2012; Jahandeh et al., 2015), several non-archetypal UPEC virulence genes (vat, fyuA, chuA, yfcV, sivH, shiA, sisA, sisB and eco274) need further investigation among clinical isolates.

In the present study, urinary E. coli isolates from Jordan were characterized by molecular techniques to identify the incidence non-archetypal virulence genes of UPEC. In addition, antibiotic susceptibility profile of the isolates was also examined. UTI management has become increasingly difficult because of the emergence of resistance to first line antimicrobials used for empiric therapy (Qin et al., 2013). Furthermore, better understanding of virulence mechanisms and pathogenesis of UTI (UPEC virulence determinants) found in clinical UPEC isolates will help in providing new strategies to treat and prevent UPEC infections.

2

2 Materials and methods

2.1

2.1 Escherichia coli isolates

The study was approved by the institutional review board of Jordan University of Science and Technology. Two hundred and twenty-seven isolates of E. coli were isolated from urine samples having significant bacterial counts (>105 CFUs/mL), obtained from patients suffering from UTIs. Pure cultures were stored frozen at −80 °C in LB broth with 10% glycerol. Samples were collected from King Abdullah University Hospital (Irbid, Jordan), Jordan University Hospital (Amman, Jordan) and Prince Hamzah Hospital (Amman, Jordan).

2.1.1

2.1.1 Identification and antimicrobial susceptibility testing

E. coli were identified based on motility, ability to ferment glucose, lactose, and sucrose, and ability to utilize citrate and tryptophan. The Kirby-Bauer disc diffusion method, using a 0.5 McFarland-equivalent bacterial suspension spread over Mueller Hinton agar media, was utilized to determine isolates’ resistance to 17 antibiotics used for the treatments of UTIs (Jenkins and Schuetz, 2012). Isolates with resistance or intermediate susceptibility were considered non-susceptible to the antimicrobial agent. Isolates demonstrating resistance or intermediate susceptibility to an antimicrobial agent were considered non-susceptible to that agent during statistical analysis. Extended-spectrum beta-lactamase (ESBL) producing isolates were identified using a phenotypic confirmatory test using ceftazidime (30 µg) versus ceftazidime (30 µg) with clavulanic acid (10 µg), and cefotaxime versus cefotaxime (30 µg) with clavulanic acid (10 µg). An isolate was identified as an ESBL producer if the difference in zone diameter was more than or equal to 5 mm for either or both combinations, according to Clinical and Laboratory Standards Institute [CLSI, 2015] recommendations.

2.1.2

2.1.2 Extraction of chromosomal and plasmid DNA

One mL of overnight LB broth bacterial culture was subjected to chromosomal DNA extraction using the Wizard® Genomic DNA Purification Kit (Promega, Madison, Wisconsin, United States), and 0.6 mL of bacterial culture was subjected to plasmid extraction using the Zyppy™ Plasmid Miniprep Kit (Zymo research, Irvine, California, United States). Isolated DNA preparations were stored frozen at −20 °C until used.

2.1.3

2.1.3 Molecular detection of UPEC virulence genes

The genes encoding several UPEC virulence factors were detected using conventional PCR technique as previously described (Mao et al., 2012; Spurbeck et al., 2012). Amplification of selected genes was done using nine sets of primers as shown in Table 1. E. coli ATCC 700928 strain (CFT073) was used as positive control for sivH, shiA, sisA, sisB, vat, fyuA, chuA, and yfcV. Eco274 PCR product was confirmed by identifying the band size following electrophoretic separation (i.e., 207 bp). E. coli ATCC 700,926 strain (MG1655) was used as a negative control for all the genes. The PCR cycling protocol for all genes was 94 °C for ten minutes, 32 cycles of 94 °C for 60 s, 50 °C for 60 s, and 72 °C for 60 s. The cycles were followed by 10 min of 72 °C.

Table 1 Primers used in the amplification of E. coli genes.
Gene Primer sequence 5′ to 3′ Product size (bp) Origin Refer-ence
sivH F TGCCGAAGTCTGGTTACCTT 185 Plasmid Mao et al. (2012)
R TCCCCGCTTTATAGTCCGTC
shiA F TCACCTTACTGGTATGAACTC 451 Plasmid Mao et al. (2012)
R TCCAGGGCCAGACATATTCA
sisA F TTGCCCGACAGGAGAATGAC 360 Chromosome Mao et al. (2012)
R GCAGTATATGGCGTGCCTGT
sisB F GAACGATAGATTATGCTTTG 518 Plasmid Mao et al. (2012)
R TCAGTACACTGAAGGCTCGC
eco274 F TTGACAAAGCCTGCCTGACC 207 Chromosome Mao et al. (2012)
R CCTCCAACCCGTGTTTTTGC
vat F TGGAACGACAGTGGAATGGA 238 Chromosome Vigil et al. (2011)
R ACCCCACACCGTAAAGCATA
fyuA F GTAAACAATCTTCCCGCTCGGCAT 850 Chromosome Vigil et al. (2011)
R TGACGATTAACGAACCGGAAGGA
chuA F CTGAAACCATGACCGTTACG 652 Chromosome Spurbeck et al. (2012)
R TTGTAGTAACGCACTAAACC
yfcV F ACATGGAGACCACGTTCACC 292 Chromosome Spurbeck et al. (2011)
R GTAATCTGGAATGTGGTCAGG

2.2

2.2 Statistical analysis

The IBM SPSS software version 21 (Armonk, NY, USA) was used for statistical analysis. The Pearson Chi-square test was used to compare frequency data. P value less than 0.05 was considered significant.

3

3 Results

Several E. coli isolates were highly resistant to several antimicrobial agents (Tables 2 and 3). Resistance ranged from 83% for augmentin to 0.4%, for ertapenem. Approximately half (49.8%) of the isolates were ESBL positive (data not shown). Among the isolates, 81.9% were resistant to three or more classes of antimicrobial agents (Table 3).

Table 2 Antimicrobial susceptibility results of the isolates.
Antimicrobial agent Intermediate; N (%) Resistant; N (%) Susceptible; N (%)
Amikacin 16 (7.1) 7 (3.1) 204 (89.9)
Augmentin 14 (6.2) 189 (83.2) 24 (10.6
Cefepime 20 (8.8) 88 (38.8) 119 (52.4)
Cefixime 38 (16.7) 45 (19.8) 144 (63.4)
Cefotaxime 2 (0.9) 129 (56.8) 96 (42.3)
Cefoxitin 42 (18.5) 48 (21.2) 137 (60.4)
Cefpodoxime 2 (0.9) 126 (55.5) 99 (43.6)
Ceftazidime 7 (3.1) 116 (51.2) 104 (45.8)
Ceftriaxone 1 (0.4) 125 (55.1) 101 (44.5)
Cefuroxime 21 (9.3) 140 (61.7) 66 (29.1
Ciprofloxacin 6 (2.6) 126 (55.5) 95 (41.9)
Ertapenem 1 (0.4) 1 (0.4) 225 (99.1)
Gentamycin 0 (0.0) 76 (33.5) 151 (66.5)
Nalidixic acid 4 (1.8) 177 (77.9) 46 (20.3)
Nitrofurantoin 28 (12.3) 29 (12.8) 170 (74.9)
Norfloxacin 45 (19.4) 12 (5.3) 170 (74.9)
Trimethoprim-sulfamethoxazole 1 (0.4) 166 (73.1) 60 (26.4)
Table 3 Isolates’ resistance to antimicrobial agent classes.
Antimicrobial agent classes’ resistance count Frequency Percent
0 10 4.4
1 9 4
2 22 9.7
3 19 8.4
4 16 7
5 41 18.1
6 48 21.1
7 47 20.7
8 15 6.6

Using PCR, urovirulence genes were detected at the following rates among the isolates: shiA (92%), sisA (72%), eco274 (44%), sivH (36%), vat (27%), yfcV (25%), sisB (25%), chuA (20%), and fyuA (18%) (Table 4). Among the isolates, 67.4% were identified as UPEC, as they were positive for three or more of the urovirulence genes.

Table 4 Prevalence of UPEC virulence genes among the isolates.
Gene Present (%)
shiA 209 (92.1)
sisA 164 (72.2)
eco274 99 (43.6)
sivH 81 (35.7)
vat 63 (27.4)
yfcV 57 (25.1)
sisB 56 (24.7)
chuA 46 (20.3)
fyuA 41 (18.1)

Finally, the profile of antibiotic resistance among the isolates was compared to that reported in other countries (Table 5). Overall, the study’s isolates had higher or similar resistance rates compared to those reported elsewhere (Table 5).

Table 5 Prevalence of antimicrobial resistance of isolates compared to other studies.
Antimicrobial agent Resistance rates according to study (%)
This study Jordan Nimri and Azaizeh (2012) Ankara Aypak et al. (2009) Pakistan Sabir et al. (2014) Brazil Dias et al. (2009) China Cao et al. (2011) Iran Farshad et al. (2012)
Amikacin 3 3 13 3 7
Augmentin 83 33 33 63 19 25
Cefepime 39
Cefixime 20 54 20
Cefotaxime 57 50 90 2
Cefoxitin 21 8
Cefpodoxime 56 69
Ceftazidime 51 48 74 67
Ceftriaxone 55 16 43 46
Cefuroxime 62 56 23 58 4 67
Ciprofloxacin 56 40 54 75 9
Ertapenem 0.4
Gentamycin 34 37 6 60 3 63 15
Nalidixic acid 78 61 10 25
Nitrofurantoin 13 4 2 3 5
Norfloxacin 5 42 11
Trimethoprim-sulfamethoxazole 73 65 41 76
ESBL* 50 50
ESBL is not an antimicrobial agent.

4

4 Discussion

In the current study, E. coli isolates involved in human UTIs were characterized by PCR to determine prevalence of UPEC virulence genes. In addition, antibiotic susceptibility profile of the isolates was also examined.

UPEC strains are responsible for the majority of uncomplicated urinary tract infections. Many putative virulence genes of UPEC have been previously identified. However, UPEC strains differ in the number and expression levels of virulence genes, leading to variations in ability to grow and persist within the urinary tract (Bien et al., 2012).

Prevalence of non-archetypal urovirulence genes of UPEC strains is poorly defined among UTI patients. One of the aims of the present study was to identify the urovirulence genes of UPEC strains isolated from UTI symptomatic patients. Specifically, the presence of sivH, shiA, sisA, sisB, eco274, chuA, yfcV, vat, and fyuA, was investigated utilizing PCR-based analyses. We considered an isolate to be a UPEC strain, if it possessed three or more of the aforementioned genes.

Statistically significant associations were identified between multiple virulence genes, as some genes were more likely to coexist with other genes. This may suggest the co-carriage of multiple virulence genes on the same plasmid. In general, the prevalence of urovirulence genes presented in the current study is consistent with those from other related studies from the USA and Taiwan (Mao et al., 2012). ShiA and sisA were the most prevalent at 92% and 72%, respectively, while fyuA was the least prevalent at 18%. The other urovirulence genes were prevalent in 20–44% of the isolates. The higher prevalence of sisA in the current study (72%) compared to sisB (25%) is consistent with other studies that reported higher sisA prevalence than sisB among UPEC isolates (Lloyd et al., 2009a; Lloyd et al., 2009b; Mao et al., 2012). This difference may be attributed to carriage of sisA mainly by extra-intestinal pathogenic E. coli strains and of sisB mainly by intestinal E. coli strains (Lloyd et al., 2009b).

Interestingly, SisA and SisB of CFT073 are homologs of ShiA of Shigella flexneri, and play a similar role in suppressing the host defense system during UTIs (Ingersoll and Zychlinsky, 2006; Lloyd et al., 2009b). Therefore, sisA and sisB which are located in pathogenicity islands, can be considered UPEC virulence factor genes. They are found in some but not all UPEC strains, which may explain the reported variability of inflammation among patients of UTIs (Lloyd et al., 2009b). The potential transcriptional regulator gene eco274 which likely encodes a virulence factor involved in pyelonephritis and urosepsis, was prevalent among approximately 44% of the isolates. SivH, which encodes a putative invasive protein, had a prevalence rate of 36%. Although, the specific urovirulence mechanisms of the products of the eco274 and sivH are yet to be identified, their association with UTIs highly suggests their identity as urovirulence genes.

FyuA, chuA, sisB, yfcV, and vat, were prevalent in 18–27% of the isolates. E. coli isolates carrying, fyuA, chuA, yfcV, and vat, were reported to colonize the urinary tract more efficiently than isolates lacking them (Spurbeck et al., 2012). In addition, the latter four genes are highly prevalent among UPEC (Mao et al., 2012; Spurbeck et al., 2012). The fyuA gene was absent from E. coli isolated from asymptomatic bacteriuria in healthy nonpregnant women (Srivastava et al., 2016). Expression of chuA gene was induced by growing UPEC strain CFT073 in urine (Alteri and Mobley, 2007). These findings confirmed the low prevalence FyuA, chuA, sisB, yfcV, and vat genes observed in the current study.

The products of chuA and fyuA, which were identified in a fifth of the isolates, are two receptors that contribute to UPEC pathogenesis during UTIs (Spurbeck et al., 2012). A study demonstrated that chuA and fyuA, contributed to systemic E. coli infections by functioning as heme and yersiniabactin receptors, respectively (Spurbeck et al., 2012).

A previous report has indicated a high correlation between vat (tsh) and UPEC infections but not to fecal E. coli strains (Heimer et al., 2004), and that vat contributed to development of systemic infections (Subashchandrabose et al., 2013). However, vat was not detected in 123 UPEC strains isolated from patients with UTIs (Momtaz et al., 2013). Therefore, vat, which was identified in 27% of this study’s isolates, might be considered as a UPEC virulence factor. More studies are required to understand the contribution of vat to UPEC pathogenesis.

In Jordan and in other countries, the improper prescription of antimicrobials by physicians, purchasing antimicrobials without prescription, and the misuse of antimicrobials by individuals, likely contributes to increasing drug resistance by bacteria (Al-Bakri et al., 2005). In addition, drug resistance among the Enterobacteriaceae is increasing worldwide. A specific concern is the increasing prevalence of ESBL-producing Enterobacteriaceae, which are involved in several difficult-to-control infection outbreaks (Canton et al., 2008). Overall, the study’s isolates had higher or similar resistance rates compared to those reported in Jordan (Abu Shaqra, 2001; Zatorski et al., 2015) and elsewhere (Aypak et al., 2009; Farshad et al., 2012; Sabir et al., 2014), which has the antimicrobial resistance profile of the isolates compared to that from other studies. The observed variations in resistance rates may be attributed to regional differences in strain prevalence and different standards and controls for prescription and use of antimicrobial agents.

According to the European antimicrobial resistance surveillance report which was published in 2011 (EARS-Net, 2012), E. coli resistance rates to aminopenicillins ranged from 39% in Finland, up to 71% in Bulgaria. Resistance to 3rd generation cephalosporins ranged from 4% in Lithuania, Sweden, and Norway, up to 30% in Slovakia, with a mean of 11%. Resistance to fluoroquinolones ranged from 11% in Finland, Sweden, and Norway, up to 42% in Cyprus and Italy. Resistance to aminoglycosides ranged from 3% in Iceland up to 24% in Romania, with a mean of 10%. All European countries had low resistant rates to carbapenems with a mean of <0.1% which is very close to our results for ertapenem at 0.4%. Our results demonstrated much higher resistance levels than those in Europe likely due to misuse and improper prescription of antimicrobials in Jordan. The rates of ESBL-producing isolates in Europe ranged from 68% in Slovakia up to 100% in Hungary, Lithuania, and Romania, with most other countries above 80% (EARS-Net, 2012). In contrast, our study isolates had a lower rate of ESBL phenotype, probably due to more prevalent use of 3rd generation cephalosporins in Europe, than in Jordan.

In conclusion, antimicrobial susceptibilities, and virulence factor profiles of E. coli isolates recovered from UTIs were determined. High rates of multi-drug resistance were reported.

Conflict of interest

The authors have no conflict of interest to declare.

Acknowledgments

The study was supported by fund from Jordan University of Science and Technology (number: 149/2013).

References

  1. , . Antimicrobial activity in urine: effect on leukocyte count and bacterial culture results. New Microbiol.. 2001;24:137-142.
    [Google Scholar]
  2. , , , . Community consumption of antibacterial drugs within the Jordanian population: sources, patterns and appropriateness. Int. J. Antimicrob. Agent.. 2005;26:389-395.
    [Google Scholar]
  3. , , , , , , , , . Molecular characterization of UpaB and UpaC, two new autotransporter proteins of uropathogenic Escherichia coli CFT073. Infect. Immun.. 2012;80:321-332.
    [Google Scholar]
  4. , , , , , , , , , . UpaH is a newly identified autotransporter protein that contributes to biofilm formation and bladder colonization by uropathogenic Escherichia coli CFT073. Infect. Immun.. 2010;78:1659-1669.
    [Google Scholar]
  5. , , . Quantitative profile of the uropathogenic Escherichia coli outer membrane proteome during growth in human urine. Infect. Immun.. 2007;75:2679-2688.
    [Google Scholar]
  6. , , , . Empiric antibiotic therapy in acute uncomplicated urinary tract infections and fluoroquinolone resistance: a prospective observational study. Ann. Clin. Microbiol. Antimicrob.. 2009;8:27.
    [Google Scholar]
  7. , , , , . Microarray long oligo probe designing for Escherichia coli: an in-silico DNA marker extraction. Cent Eur. J. Urol.. 2016;69:105-111.
    [Google Scholar]
  8. , , , . Role of uropathogenic Escherichia coli virulence factors in development of urinary tract infection and kidney Damage. Int. J. Nephrol.. 2012;2012:681473.
    [Google Scholar]
  9. , , , , , , , . Prevalence and spread of extended-spectrum beta-lactamase-producing Enterobacteriaceae in Europe. Clin. Microbiol. Infect.. 2008;14(Suppl 1):144-153.
    [Google Scholar]
  10. , , , , , , , , , . Molecular characterization and antimicrobial susceptibility testing of Escherichia coli isolates from patients with urinary tract infections in 20 Chinese hospitals. J. Clin. Microbiol.. 2011;49:2496-2501.
    [Google Scholar]
  11. , , , , . Virulence plasmid harbored by uropathogenic Escherichia coli functions in acute stages of pathogenesis. Infect. Immun.. 2010;78:1457-1467.
    [Google Scholar]
  12. , , , , , , , . Clonal composition of Escherichia coli causing community-acquired urinary tract infections in the State of Rio de Janeiro, Brazil. Microb. Drug Resist.. 2009;15:303-308.
    [Google Scholar]
  13. EARS-Net, 2012. Antimicrobial Resistance Surveillance in Europe 2011. Annual Report of the European Antimicrobial Resistance Surveillance Network: Stockholm, Sweden.
  14. , , , , , , . Microbial susceptibility, virulence factors, and plasmid profiles of uropathogenic Escherichia coli strains isolated from children in Jahrom, Iran. Arch. Iran. Med.. 2012;15:312-316.
    [Google Scholar]
  15. , , , , , , . Host-pathogen checkpoints and population bottlenecks in persistent and intracellular uropathogenic Escherichia coli bladder infection. FEMS Microbiol. Rev.. 2012;36:616-648.
    [Google Scholar]
  16. , , , , , . Autotransporter genes pic and tsh are associated with Escherichia coli strains that cause acute pyelonephritis and are expressed during urinary tract infection. Infect. Immun.. 2004;72:593-597.
    [Google Scholar]
  17. , , . ShiA abrogates the innate T-cell response to Shigella flexneri infection. Infect. immun.. 2006;74:2317-2327.
    [Google Scholar]
  18. , , , , . Uropathogenic Escherichia coli virulence genes: invaluable approaches for designing DNA microarray probes. Cent. Eur. J. Urol.. 2015;68:452-458.
    [Google Scholar]
  19. , , . Current concepts in laboratory testing to guide antimicrobial therapy. Mayo Clin. Proceed.. 2012;87:290-308.
    [Google Scholar]
  20. , , , , . Genomic islands of uropathogenic Escherichia coli contribute to virulence. J. Bacteriol.. 2009;191:3469-3481.
    [Google Scholar]
  21. , , , , . Uropathogenic Escherichia coli Suppresses the host inflammatory response via pathogenicity island genes sisA and sisB. Infect. Immun.. 2009;77:5322-5333.
    [Google Scholar]
  22. , , , , , , , , , , , , . Identification of Escherichia coli genes associated with urinary tract infections. J. Clin. Microbiol.. 2012;50:449-456.
    [Google Scholar]
  23. , , , , , , , . Uropathogenic Escherichia coli in Iran: serogroup distributions, virulence factors and antimicrobial resistance properties. Ann. Clin. Microbiol. Antimicrob.. 2013;12:8.
    [Google Scholar]
  24. , , . First report of multidrug-resistant ESBL-producing urinary Escherichia coli in Jordan. Br. Microbiol. Res. J.. 2012;2:71-81.
    [Google Scholar]
  25. , , , , , , , . Comparison of adhesin genes and antimicrobial susceptibilities between uropathogenic and intestinal commensal Escherichia coli strains. PLoS One. 2013;8:e61169.
    [Google Scholar]
  26. , , , , . Autotransporter-encoding sequences are phylogenetically distributed among Escherichia coli clinical isolates and reference strains. Appl. Environ. Microbiol.. 2007;73:1553-1562.
    [Google Scholar]
  27. , , , , , , . Expression of different bacterial cytotoxins is controlled by two global transcription factors, CRP and Fis, that co-operate in a shared-recruitment mechanism. Biochem. J.. 2015;466:323-335.
    [Google Scholar]
  28. , , , , , , . Isolation and antibiotic susceptibility of E. coli from urinary tract infections in a tertiary care hospital. Pak. J. Med. Sci.. 2014;30:389-392.
    [Google Scholar]
  29. , , , , , , , , , . Escherichia coli isolates that carry vat, fyuA, chuA, and yfcV efficiently colonize the urinary tract. Infect. Immun.. 2012;80:4115-4122.
    [Google Scholar]
  30. , , , , , , . Fimbrial profiles predict virulence of uropathogenic Escherichia coli strains: contribution of ygi and yad fimbriae. Infect. Immun.. 2011;79:4753-4763.
    [Google Scholar]
  31. , , , , . Virulence versus fitness determinants in Escherichia coli isolated from asymptomatic bacteriuria in healthy nonpregnant women. Indian J. Med. Microbiol.. 2016;34:46-51.
    [Google Scholar]
  32. , , , , , . Genome-wide detection of fitness genes in uropathogenic Escherichia coli during systemic infection. PLoS Pathogens. 2013;9:e1003788.
    [Google Scholar]
  33. , , , , . TonB-dependent systems of uropathogenic Escherichia coli: aerobactin and heme transport and TonB are required for virulence in the mouse. Infect. Immun.. 2001;69:6179-6185.
    [Google Scholar]
  34. , , , , , , , . Presence of putative repeat-in-toxin gene tosA in Escherichia coli predicts successful colonization of the urinary tract. MBio. 2011;2:e00066-00011.
    [Google Scholar]
  35. , , , , . Identification of antigen Ag43 in uropathogenic Escherichia coli Dr+ strains and defining its role in the pathogenesis of urinary tract infections. Microbiology. 2015;161:1034-1049.
    [Google Scholar]
  36. , , , , , . Comparison of antibiotic susceptibility of Escherichia coli in urinary isolates from an emergency department with other institutional susceptibility data. Am. J. Health-Syst. Pharm.. 2015;72:2176-2180.
    [Google Scholar]
  37. , , , , , , , , , , . Characterization and functional analysis of AatB, a novel autotransporter adhesin and virulence factor of avian pathogenic Escherichia coli. Infect. Immun.. 2013;81:2437-2447.
    [Google Scholar]
  38. , , , . Prevalence of autotransporters in Escherichia coli: What is the impact of phylogeny and pathotype? Int. J. Med. Microbiol.. 2014;304:243-256.
    [Google Scholar]
Show Sections