Translate this page into:
TRI5 positive Fusarium graminearum strains isolated from different hosts cause root rot and head blight diseases of wheat (Triticum aestivum L.)
*Corresponding author: E-mail address: nadeem_hassan@comsats.edu.pk (M Hassan)
-
Received: ,
Accepted: ,
Abstract
Fusarium graminearum is an economically important pathogen of cereal crops. It causes Fusarium root rot (FRR) and Fusarium head blight (FHB) in wheat, posing a significant threat to food security by reducing wheat yields. The cropping pattern under intensive farming has led to the emergence of new pathotypes. This study aims to assess the pathogenic potential of F. graminearum strains isolated from different hosts on wheat. Twenty isolates (presumptively Fusarium spp.) were obtained from symptomatic plants of various crops, including wheat, maize, and grass. Four out of 20 isolates were identified as F. graminearum based on Trichodiene synthase (TRI5) primer and internal transcribed spacer (ITS) gene analysis. All these strains (n=4) caused Fusarium root rot and Fusarium head blight diseases in wheat susceptible varieties. The F. graminearum strain F1 was found to be highly virulent on both varieties, with a root rot disease score, i.e., Seher (2.9), Galaxy (2.1), and head blight disease score on Seher (5.5) and Galaxy (3.3). None of the strains caused disease on the resistant variety Akbar (disease score 0.6). The virulent strains caused a reduction in photosynthetic pigments, i.e., chlorophyll a, (24-68%), chlorophyll b (26-55%), and carotenoids (17-63%) over control in Seher (susceptible) and Galaxy (moderate susceptible). An enhanced activity of the malondialdehyde (MDA) (6-82%) and antioxidant enzymes was observed in plants inoculated with F. graminearum strains. A significant correlation was observed between the disease score and stress-related markers. These findings highlight the cross-host pathogenicity of F. graminearum on wheat prevailing in different field crops.
Keywords
Chlorophyll
Disease score
Pathogenicity
Superoxide dismutase
Trichodiene synthase
1. Introduction
Fusarium graminearum is a devastating pathogen of cereals that causes Fusarium head blight (FHB). Wheat and maize are two important cereals that provide approximately 20% of the global dietary protein and caloric intake (Li et al., 2013). Wheat is severely affected by the F. graminearum, leading to Fusarium root rot (FRR) and FHB. F. graminearum produces trichothecenes, which are catalyzed by the trichodiene synthase, a key enzyme for initiation of deoxynivalenol (DON) and its chemo-types (Alisaac & Mahlein, 2023; Qu et al., 2024). Trichodiene synthase is encoded by the gene TRI5, which is the key factor in the pathogenicity of F. graminearum.
F. graminearum strains could cause pathogenicity on their alternate hosts (maize and grass) and pose a significant challenge for disease management. The cropping pattern of maize-wheat facilitates the establishment of a pathogen reservoir (Johns et al., 2022). F. graminearum produces both asexual macro conidia and sexual ascospores. These spores later form perithecia on infected crop residues, predominantly under less tillage systems (Brauer et al., 2020). These perithecia assist as primary overwintering structures, helping the pathogen for long-term survival on residues of host crops. In the growing season, airborne ascospores are discharged and dispersed by wind and rain. They germinate under specific humidity (≥90%), and moderate temperature (20–30°C) and develop disease. Agro-climatic conditions of Azad Jammu and Kashmir (AJ&K) are favorable for the cultivation of cereal crops, mainly wheat and maize (Hussain et al., 2017). Subtropical agro-ecological zone Azad Kashmir, including Bhimber, Mirpur, and Kotli, is characterized by favorable environmental conditions such as warm summers, fertile soils, moderate winters, and reliable irrigation systems, making it productive for the cultivation of cereal crops. Bhimber is geographically located with borders of Punjab, Pakistan, to the south and the Indian-administered Jammu to the east. This territory makes it a key area for monitoring cross-border pathogen dynamics (Lone et al., 2021).
F. graminearum has the potency to cause pathogenicity on alternate hosts, but cross-pathogenicity remains unexplored. The identification of an etiological agent plays a key role in effective management of disease control strategies (Chulze et al., 2023). Identification of species based on morphological characteristics is unreliable due to the overlap in spores and mycelium morphology of different fungi. However, molecular identification using a polyphasic approach, including phenotypic, genotypic, and phylogenetic analysis, has become essential (Samarakoon et al., 2018). This study aims to a) assess cross-host pathogenicity of TRI5-positive F. graminearum strains isolated from different wheat, maize, and grass varieties, and b) assess the toxigenic potential on wheat varieties by analyzing disease score, pigment reduction, and antioxidant enzyme activity. These objectives are projected to facilitate better-quality Fusarium management in the agriculture and livestock feed sectors.
2. Materials and Methods
2.1 Fusarium isolation and presumptive identification
Symptomatic parts (leaves/stem/spikes etc.) of wheat, maize and grass were randomly collected from different areas of cultivation in Azad Jammu & Kashmir (Fig. 1). Samples were disinfected by soaking in ethanol (70%) for 45 s and sodium hypochlorite (NaOCl, 0.5%) for 2-3 min and were washed twice with autoclaved distilled water (Ma et al., 2024). After drying on a sterile filter paper, the samples were placed on a semi-selective Fusarium agar (malachite green agar) (Mukesh et al., 2025) until the appearance of fungal mycelium. Each isolate was purified by the single-spore method. Fusarium spp. were presumptively identified based on pigmentation and spore morphology (Shahnazi et al., 2012).
2.2 Molecular identification and phylogenetic analysis of Fusarium graminearum
F. graminearum strains were screened based on the presence of trichodiene synthase (TRI5) gene and identified by internal transcribed spacer (ITS) gene analysis. The DNA was extracted by the CTAB method (Nikiema et al., 2023) and was visualized by agarose gel electrophoresis on a gel documentation system (Biometra, Germany). Based on the diversity of the TRI5 gene (analyzed in silico), new primers TRI5-F 5’TCCTCCGCTTATTGATATGC’3 and TRI5-R. 5’CAATTCCAATCGCAGACAA’3 was designed in this study and used for amplification of the gene. The TRI5 positive strains were identified by ITS gene analysis by using the primer as described in earlier studies (Singha et al., 2016). A Polymerase chain reaction (PCR) reaction consisted of Taq buffer (1x), 2 µL MgCl2 (25mM), 1.5 µL dNTPs (10 mM), 1 µL of each primer (10 pM), 0.25 µL Taq polymerase (500 U), and 2.5 µL template DNA (35 ng/uL) and was amplified in a thermal cycler (Applied Biosystems, United States) with the cycling conditions (initial denaturation at 95°C for 3 min followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 1 min and 1 cycle of final extension at 72°C for 5 min. The PCR products were visualized by gel electrophoresis and purified using a PCR purification kit (Thermo Scientific). The ITS gene of each fungus was sequenced commercially by Macrogen Inc., South Korea. The obtained sequences were analyzed for homology with the closest strain and submitted to the NCBI GenBank. Phylogeny was constructed using the neighbor-joining method with the Kimura 2-parameter model at a bootstrap value (1,000 replicates) (Afzal et al., 2019).
2.3. Pathogenicity of F. graminearum strains on wheat
Pathogenicity of F. graminearum strains was assessed for root rot and Fusarium head blight of wheat.
2.3.1 Root rot severity
The pathogenicity of F. graminearum strains causing root disease was assessed in a petri plate experiment. F. oxysporum (Ullah et al., 2020) was used as a positive control, and sterile water was used as a negative control. Seeds of two varieties, i.e., Seher (highly susceptible) and Galaxy (moderately susceptible), were obtained from the National Agricultural Research Center (NARC), Islamabad, Pakistan. The seeds were sterilized in 2% sodium hypochlorite for 3 min and rinsed 3-4 times with sterile double-distilled water. The sterilized seeds (n=9) were placed in each petri plate (150 mm) containing moist filter paper and incubated in the dark until germination. F. graminearum inoculum was prepared by growing the culture on plates in the dark at 26±2°C for 6-7 days. The conidia were harvested by flooding the cultures with sterile distilled water and filtering through two layers of sterile cheesecloth to remove mycelia. Spore concentration was adjusted to 5 × 106 spores/ml by hemocytometer (Marienfeld-Superior, Germany). A 0.75-1 mL suspension (5 × 106 spores/mL) was applied to the newly emerged root of each plant (5 days post-sowing). The inoculated plants were kept at 26±2°C under humidity (∼80%) until the appearance of maximum symptoms (10 days post inoculation (dpi)). The Disease severity on roots and crowns was scored on a 0–3 scale as described by (Cong et al., 2018), i.e., No symptoms (healthy roots and crown) = 0, Browning on the roots =1, Browning extending from roots to the crown = 2, and Dark brown coloration of the crown and all roots= 3
2.3.2 Head blight severity
The pathogenicity of F. graminearum strains causing head blight disease was assessed under greenhouse conditions (20–22°C, 16-h photoperiod, and 60–70% relative humidity). Wheat seeds were sterilized as described above and sown in a sterilized mixture (soil (2): sand (1): peat (1)) in plastic pots. The fungal inoculum was prepared as described above, and plants were inoculated at the mid-anthesis stage. The disease was assessed (10 dpi) and scored on (0-8) scales as described by Al-Hashimi et al., (2025) no symptoms (healthy) = 0, 1-10% damaged spikelets = 1, 11- 20% damaged spikelets = 2, 21-30% damaged spikelets = 3, 31-40% damaged spikelets = 4, 41-50%= 5, 51-60%= 6, 61-80%= 7, and 81-100%= 8.
2.4. Effect of Fusarium graminearum on photosynthetic pigments
Photosynthetic pigments (i.e., chlorophyll a, chlorophyll b, and carotenoids) were analyzed in all treatments. Briefly, 0.1 g of leaves was placed in 10 mL of 80% acetone for 2–3 days and filtered through Whatman filter paper. The absorbance of the filtrate was measured at 663 nm, 645 nm, and 440 nm as described by Lichtenthaler (1987)
2.5. Malondialdehyde (MDA) content
Malondialdehyde (MDA) content was determined following the method of (Sorahinobar et al., 2022). Spikelets (0.5 g) were homogenized in 2.5 mL of 0.1% (w/v) trichloroacetic acid (TCA) and centrifuged at 10,000×g. A 1 mL aliquot of the supernatant was mixed with 4 mL of 0.5% thiobarbituric acid (TBA) prepared in 20% TCA. The mixture was incubated at 95°C for 30 min, rapidly cooled in an ice bath, and centrifuged at 10,000×g for 15 min. The absorbance of the supernatant was measured at 532 nm and 600 nm.
2.6 Determination of antioxidant enzymes
The activities of the antioxidant enzymes, superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) were measured in the wheat spikelets after 10 days of post-inoculation. Wheat tissues (0.5 g) were ground in phosphate buffer (pH 7.0) with 1% polyvinyl pyrrolidone (PVP). The homogenate was centrifuged at 4000×g for 30 min, and the supernatant was passed through a syringe filter (10 mL) and stored at ultra-low temperature (-80°C) for enzyme assays. SOD activity was measured by following the method of Sorahinobar et al., (2022). Activity was assessed based on the photo-reduction of nitro blue tetrazolium. Reaction mixture consisted of 13 mM methionine, 63 µM NBT, 1.3 µM riboflavin, 0.05M sodium carbonate (pH 10.2), and 100 µL crude enzyme extract. The absorbance was measured at 560 nm, and activity was expressed in U/mg fresh weight. POD activity was measured by following the method of Frei et al., (2010). The reaction mixture consisted of 4 mM guaiacol, 50mM KH2PO4/K2HPO4 (pH 7.0), 10 mM H2O2, and 100 μL enzyme extract. The c absorbance was recorded at 470 nm, and enzyme activity (ε=26.6 mM−1 cm−1) was expressed in U/mg fresh weight. CAT activity was measured by quantifying the degradation of hydrogen peroxide (H2O2) as described by Pazdiora et al., 2023.
2.7. Statistical analysis
All the data were analyzed using the statistical package Statistics 8.1. One-way One-way Analysis of Variance (ANOVA) was applied to the numeric data, followed by the Tukey’s HSD (honestly significant difference test) for mean separation at a significance level of p ≤ 0.05 (Sorahinobar et al., 2022).
3. Results
3.1 Isolation and presumptive identification of Fusarium spp.
Fungal strains (n = 60) were isolated from wheat, maize, and grass grown at different locations of Azad Jammu and Kashmir, as shown in Fig. 1. Out of 60, 20 strains were identified as Fusarium species based on their pigmentation and spore morphology (Table 1). Fusarium strains produced different pigmentation, i.e., light purple (n = 4), dark purple (n = 5), yellow (n = 8), and no pigmentation (n = 3). Mycelium growth was considerably more variable in Fusarium, with some isolates displaying white mycelial growth patterns that varied from fluffy and sparse to mixed (Fig. 2).
| Isolates | Host | Mycelium morphology | Pigmentation | 1Presumptive Identification |
|---|---|---|---|---|
| F1 | Wheat | Condensed | Yellow | Fusarium spp. |
| F3 | Maize | Condensed | Light purple | Fusarium spp. |
| F4 | Grass | Condensed | Yellow | Fusarium spp. |
| F 5 | Wheat | Condensed | Dark purple | Fusarium spp. |
| F 6 | Wheat | Condensed | Yellow | Fusarium spp. |
| F 7 | Maize | Fluffy | Yellow | Fusarium spp. |
| F 8 | Grass | Fluffy | Purple | Fusarium spp. |
| F 9 | Wheat | Fluffy | No | Fusarium spp. |
| F 10 | Maize | Fluffy | Fusarium spp. | |
| F 11 | Maize | Sparse | Purple | Fusarium spp. |
| F 12 | Maize | Fluffy | Purple | Fusarium spp. |
| F 13 | Maize | Sparse | Purple | Fusarium spp. |
| F 14 | Maize | Fluffy | Purple | Fusarium spp. |
| F 15 | Wheat | Fluffy | Purple | Fusarium spp. |
| F 16 | Grass | Fluffy | Purple | Fusarium spp. |
| F 17 | Grass | Fluffy | Purple | Fusarium spp. |
| F 18 | Grass | Fluffy | Yellow | Fusarium spp. |
| F 19 | Grass | Condensed | Purple | Fusarium spp. |
| F 20 | Grass | Condensed | Purple | Fusarium spp. |
1Based on growth on selective agar and conidial morphology
3.2 Molecular Identification of Fusarium graminearum
Fusarium graminearum was first screened using the TRI5 gene (Fig. 2). and confirmed by ITS gene analysis. Their nucleotides were submitted to GenBank under accession numbers PP737912, PP738010, PP739729, and PQ559830. The phylogenetic analysis depicted host and regional diversity between Fusarium graminearum isolates. Strains obtained from wheat, maize, and grasses did not cluster strictly according to host, representing a multiple host range to cause cross-infectivity. Strains derived from wheat (F1, F5, ITS4, FSHG, KB-41, Moh.F.gra.1) were distributed across multiple clades, indicating intraspecific diversity within this host as shown in Fig. 2.
3.3 Root rot (RR) and head blight (HB) disease severity on wheat
F. graminearum strains caused variable disease scores in the Seher (highly susceptible) and Galaxy (moderately susceptible) varieties, reflecting their distinct pathogenicity levels (Fig. 3). The F1 strain showed the highest disease score (2.3-2.8 (RR) and 3.6-5.3(HB) similar to that of the positive control. The variety of Fungi and their interactions had a significant effect on root rot severity, as shown in Table 2.
| Source | DF | F | P | |||
|---|---|---|---|---|---|---|
| FRR | FHB | FRR | FHB | FRR | FHB | |
| Fungi | 4 | 4 | 6.63 | 37.14 | ≤ 0.05 | ≤ 0.05 |
| Variety | 1 | 2 | 0.03 | 90.07 | ≤ 0.05 | ≤ 0.05 |
| Fungi*Variety | 4 | 8 | 0.53 | 2.29 | ≤ 0.05 | ≤ 0.05 |
| Error | 20 | 30 | 0.23 | 9.18 | ||
| Total | 29 | 44 | ||||
DF= degree of freedom, F= F value, P= probability, ≤ equal or less than, FRR=Fusarium root rot, FHB= Fusarium head blight.
3.4 Analysis of photosynthetic pigments, MDA content, and antioxidant enzymes
The highest virulent F1 strain caused a maximum reduction in the photosynthetic pigments of wheat varieties, i.e., chlorophyll a (24-68%), chlorophyll b (26-55%), and carotenoids (17-63%) over control in Seher (susceptible) and Galaxy (moderately susceptible). An enhanced activity of the MDA (6-82%) and antioxidant enzymes (except catalase) was observed in plants inoculated with F. graminearum strains (Figs. 4-5). The effect of fungi and variety was found to be significant (Table 3). A significant correlation was observed between disease severity, photosynthetic pigments, and antioxidant enzymes (Fig. 6).
| Source | DF | SOD | POD | CAT | MDA | Chla | Chlb | Car | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| F | P | F | P | F | P | F | P | F | P | F | P | F | P | ||
| Fungi | 4 | 44.75 | ≤ 0.05 | 13.23 | ≤ 0.05 | 0.6 | NS | 97.10 | ≤ 0.05 | 229.81 | 0.003 | 138.54 | ≤ 0.05 | 175.27 | ≤ 0.05 |
| Variety | 2 | 122.59 | ≤ 0.05 | 87.81 | ≤ 0.05 | 0.10 | NS | 82.75 | ≤ 0.05 | 247.13 | 0.004 | 22.50 | ≤ 0.05 | 14.13 | ≤ 0.05 |
| Fungi*Variety | 8 | 28.58 | ≤ 0.05 | 5.50 | ≤ 0.05 | 0.45 | NS | 18.72 | ≤ 0.05 | 62.38 | 0.002 | 36.36 | ≤ 0.05 | 29.50 | ≤ 0.05 |
| Total | 44 | ||||||||||||||
DF= degree of freedom, SOD= Superoxide dismutase, POD= Peroxidase, MDA= Malondialdehyde, Chla= Chlorophyll a, Chlb=Chlorophyll b, F= F value, P= probability, ≤= equal or less than, NS= non- significant
4. Discussion
Global food production is a major concern due to a fast-growing population and the impacts of climate change, which affect both abiotic and biotic components. Cereal crops, such as wheat, are vulnerable due to their broad cultivation and sensitivity to pathogens. The emergence of different pathotypes and a multiple host range in F. graminearum reflects its adaptability to diverse cereal hosts. In this context, Fusarium species represent a major concern, particularly due to their role in Fusarium head blight (FHB) and Fusarium root rot (FRR). Researchers identify Fusarium species based mainly on their macro morphological characteristics, such as spore morphology and pigmentation etc. Morphological identification of F. graminearum is often unreliable due to overlap in colony and spore characteristics among species, generating problems in accurate diagnosis. This drawback emphasizes the need for molecular identification, which provides reliable identification. Certain functional genes, such as the TRI5 gene, could serve as reliable markers for identifying pathogenic isolates and assessing virulence potential. In the present study, morphological identification revealed notable diversity among isolates, displaying white mycelial growth patterns that varied from fluffy and sparse to mixed, similar to earlier reports (Pavlovic et al., 2016), suggesting that Fusarium species display significant morphological and genetic variation across different geographic regions and host plants. In this study, Fusarium isolates were first screened using the TRI5 gene to identify toxigenic potential, and subsequent ITS analysis confirmed species identity. Highlighting the complementary role of functional and universal markers in precise pathogen classification.
This study investigated different strains of Fusarium graminearum and their linkage with FRR and FHB in wheat. The observed differences in disease scores revealed variation in virulence levels. Our findings highlighting the pathogenicity of F. graminearum in both Seher and Galaxy are consistent with findings by Shikur Gebremariam et al. (2018) and Özer et al. (2019). The F. graminearum strain’s pathogenicity is possibly associated with its mechanism of infection, which comprises invading the host tissue. They penetrate host tissues through lesions or natural openings, inhabiting vascular systems, and are able to produce a wide range of cell wall-degrading enzymes. This leads to extensive root browning, damaging small growth, and spike infection. Infected residues accumulated due to root infections that harbor viable F. graminearum propagules. These propagules serve as the primary inoculum for FHB epidemics under favorable environmental conditions (Goswami & Kistler, 2004). In contrast, earlier studies mainly focused primarily on either FRR or FHB, our study shows the dual virulence of Fusarium graminearum strains on both roots and spikes under controlled conditions. Disease scores reveal variation in pathogenicity among strains is isolate dependent and controlled by genetic factors such as trichothecene biosynthetic genes. The TRI5 gene plays a critical role in DON and trichothecenes nivalenol (NIV) production, which not only increases virulence but also facilitates cross-infection among cereals (Audenaert et al., 2013). Our study depicts the concept of cross-host pathogenicity of F. graminarium regardless of host.
Physiological measurements further highlighted that the elevated stress induced by F. graminearum strains resulted in a noticeable decline in photosynthetic pigments. The most significant reduction observed in wheat varieties in Seher and Galaxy as compared to Akbar is consistent with previous findings by Agathokleous et al. (2020). A similar trend of pathogenic response of the F1 strain was noted for Chl b and Car in Seher and Galaxy as compared to other strains. These differences may reflect genotype-specific responses to varying virulence among Fusarium strains. Additionally, content declined in wheat varieties, further implying stress-induced disruption of the photosynthetic apparatus. This reduction suggests that the pathogen not only degraded pigments directly but also impaired chloroplast structure and function, limiting light absorption, electron transport, and overall energy conversion efficiency in the plants. These conclusions are consistent with the work of Sunic et al., (2023), who concluded similar variability of Fusarium graminearum isolates among wheat cultivars.
The Fusarium graminearum (F1 strain) inoculated plants depict an oxidative stress profile, highlighting its significant virulence as compared to other strains. Malondialdehyde is a marker of lipid peroxidation that was considerably raised in Seher and Galaxy as compared to Akbar. These results are close to those of Spanic et al., (2019), who reported a parallel tendency of Fusarium graminearum infection on wheat varieties triggers an oxidative burst, initiating a rapid release of reactive oxygen species (ROS) such as hydrogen peroxide and superoxide radicals.
The Fusarium graminearum strains reveal variation in pathogenic potential. The virulence initiated by Fusarium graminearum (F1) causes elevated antioxidant responses, with POD and SOD activities increasing in Akbar and Galaxy as compared to other strains. Our study is consistent with earlier reports (Spanic et al., 2019; Pastuszak et al., 2021), in which they reported the parallel antioxidant elevation in wheat genotypes under F. graminearum stress. On the other hand, a decrease in CAT activity in all varieties was observed under biotic stress F. graminearum (F1), as compared to other strains. Sorahinobar et al., (2022) also reported that the host might have less efficient hydrogen peroxide detoxification mechanisms. Antioxidant enzymes (SOD, POD, and CAT) are primarily involved in detoxifying ROS formed during pathogen attack or stress.
5. Conclusions
Our finding depicts that the TRI5 gene could be used as a potential marker for identifying the F. graminearum strains. Moreover, F. graminearum strains have developed pathotypes that can infect wheat. This cross-host virulence increases the threat to wheat production and demands effective epidemiological surveillance for the management of wheat diseases.
Acknowledgment
The authors are thankful to Crop Sciences Institute (CSI), National Agricultural Research Centre (NARC) Islamabad, Pakistan for providing the plant growing facilities. The authors acknowledge and appreciate the Ongoing Research Funding Program (ORF-2026-173), King Saud University, Riyadh, Saudi Arabia.
CRediT authorship contribution statement
Shabnum Nazir: Conceptualization, data curation, formal analysis, investigation, methodology, project administration, resources, software, supervision, validation, visualization, writing – original draft; Muhammad Nadeem Hassan: Conceptualization, data curation, formal analysis, investigation, methodology, resources, validation, visualization, writing – original draft; Humaira Yasmin: Conceptualization, methodology, resources, software, validation, visualization, writing – original draft, writing – review & editing; Pari Wash: Methodology, resources, software; Sha Mulk: Validation, visualization, writing – original draft; Sumaira: Writing – review & editing; Zahid Mamood: Conceptualization, methodology; Shikha Alnamer: Resources, software, validation, visualization; Naeem Khan: Writing – original draft, writing – review & editing; Mona S. Alwahibi: Conceptualization, data curation, formal analysis, investigation, methodology, project administration, resources, software.
Declaration of competing interest
The authors declare that they have no competing financial interests or personal relationships that could have influenced the work presented in this paper.
Declaration of generative AI and AI-assisted technologies in the writing process
The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.
References
- Plant beneficial endophytic bacteria: Mechanisms, diversity, host range and genetic determinants. Microbiol Res. 2019;221:36-49. https://doi.org/10.1016/j.micres.2019.02.001
- [Google Scholar]
- Chlorophyll hormesis: Are chlorophylls major components of stress biology in higher plants? Sci Total Environ. 2020;726:138637. https://doi.org/10.1016/j.scitotenv.2020.138637
- [Google Scholar]
- Survey and identification of fusarium head blight pathogens of wheat in the western cape region of South Africa. Pathogens. 2025;14:80. https://doi.org/10.3390/pathogens14010080
- [Google Scholar]
- Fusarium head blight on wheat: Biology, modern detection and diagnosis and integrated disease management. Toxins (Basel). 2023;15:192. https://doi.org/10.3390/toxins15030192
- [Google Scholar]
- Deoxynivalenol: A major player in the multifaceted response of Fusarium to its environment. Toxins (Basel). 2013;6:1-19. https://doi.org/10.3390/toxins6010001
- [Google Scholar]
- Regulation and dynamics of gene expression during the life cycle of Fusarium graminearum. Phytopathology. 2020;110:1368-1374. https://doi.org/10.1094/PHYTO-03-20-0080-IA
- [Google Scholar]
- Editorial: Fusarium species as plant and human pathogens, mycotoxin producers, and biotechnological importance. Front Fungal Biol. 2023;4:1320198. https://doi.org/10.3389/ffunb.2023.1320198
- [Google Scholar]
- A rapid screening method for evaluating resistance of alfalfa (Medicago sativa l.) to Fusarium root rot. Can J Plant Pathol. 2018;40:61-69. https://doi.org/10.1080/07060661.2017.1402822
- [Google Scholar]
- Biochemical factors conferring shoot tolerance to oxidative stress in rice grown in low zinc soil. Funct Plant Biol. 2010;37:74-84. https://doi.org/10.1071/fp09079
- [Google Scholar]
- Heading for disaster: Fusarium graminearum on cereal crops. Mol Plant Pathol. 2004;5:515-525. https://doi.org/10.1111/j.1364-3703.2004.00252.x
- [Google Scholar]
- Investigation of Seed Damaging Pathogens Associated with Wheat Crop in Bhimber Azad Kashmir, Pakistan and Their Managements. Journal of the Chemical Society of Pakistan. 2017;39:161-168. https://doi.org/10.24294/nrcr.v6i1.2130
- [Google Scholar]
- Emerging health threat and cost of Fusarium mycotoxins in European wheat. Nat Food. 2022;3:1014-1019. https://doi.org/10.1038/s43016-022-00655-z
- [Google Scholar]
- Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. In: Methods in Enzymology. Academic Press. Elsevier; 1987. p. :350-382. https://doi.org/10.1016/0076-6879(87)48036-1
- [Google Scholar]
- Diversity and distribution of the banana wilt pathogen Fusarium oxysporum f. sp. cubense in China. Fungal Genomics and Biology. 2013;3(2)
- [Google Scholar]
- Geospatial dynamics of cropping pattern and agricultural efficiency in Kashmir Valley-A Northwestern Himalayan Region, India. Sust. Agric. Food Env. Res. 2021;9 https://doi.org/10.7770/safer-v0n0-art1913
- [Google Scholar]
- Isolation, characterization, and pathogenicity of Fusarium species causing crown rot of wheat. Front Microbiol. 2024;15:1405115. https://doi.org/10.3389/fmicb.2024.1405115
- [Google Scholar]
- Fungal decline in pomegranate orchards: Exploring the role of organic amendments in reducing pathogen impact. J Plant Dis Prot . 2025;132 https://doi.org/10.1007/s41348-025-01142-w
- [Google Scholar]
- Molecular identification of Fusarium species associated with rice seeds produced in Burkina Faso. J Agriculture Environ Sci. 2023;12:6-17. https://doi.org/10.5281/zenodo.8224184
- [Google Scholar]
- First report of Fusarium hostae causing crown rot on wheat in Azerbaijan. Plant Disease. 2019;103:3278. https://doi.org/10.1094/pdis-05-19-1035-pdn
- [Google Scholar]
- Physiological and biochemical response to Fusarium culmorum infection in three durum wheat genotypes at seedling and full anthesis stage. Int J Mol Sci. 2021;22:7433. https://doi.org/10.3390/ijms22147433
- [Google Scholar]
- Morphology, pathogenicity and molecular identification of Fusarium spp associated with anise seeds in Serbia. Not Bot Horti Agrobo. 2016;44:411-417. https://doi.org/10.15835/nbha44210488
- [Google Scholar]
- Silicon amendment improves wheat defence against\n Fusarium graminearum\n and complements the control by fungicide of Fusarium head blight. Plant Pathol. 2023;72:53-66. https://doi.org/10.1111/ppa.13648
- [Google Scholar]
- Fusarium mycotoxins: The major food contaminants. mLife. 2024;3:176-206. https://doi.org/10.1002/mlf2.12112
- [Google Scholar]
- Colletotrichum acidae sp. nov. from northern Thailand and a new record of c. dematium on Iris sp. Mycosphere. 2018;9:583-597. https://doi.org/10.5943/mycosphere/9/3/9
- [Google Scholar]
- Morphological and molecular characterization of Fusarium spp. associated with yellowing disease of black pepper (Piper nigrum l.) in Malaysia. J Gen Plant Pathol. 2012;78:160-169. https://doi.org/10.1007/s10327-012-0379-5
- [Google Scholar]
- Identity and pathogenicity of Fusarium species associated with crown rot on wheat (Triticum spp.) in Turkey. Eur J Plant Pathol. 2018;150:387-399. https://doi.org/10.1007/s10658-017-1285-7
- [Google Scholar]
- Identification and characterization of Fusarium sp. using ITS and RAPD causing fusarium wilt of tomato isolated from Assam, North East India. J Genet Eng Biotechnol. 2016;14:99-105. https://doi.org/10.1016/j.jgeb.2016.07.001
- [Google Scholar]
- Salicylic acid seed priming enhanced resistance in wheat against Fusarium graminearum seedling blight. J Plant Biol. 2022;65:423-434. https://doi.org/10.1007/s12374-021-09329-y
- [Google Scholar]
- Changes in antioxidant system during grain development of wheat (Triticum aestivum l.) and relationship with protein composition under FHB stress. Pathogens. 2019;9:17. https://doi.org/10.3390/pathogens9010017
- [Google Scholar]
- Fusarium head blight infection induced responses of six winter wheat varieties in ascorbate–Glutathione pathway, photosynthetic efficiency and stress hormones. Plants. 2023;12:3720. https://doi.org/10.3390/plants12213720
- [Google Scholar]
- Multitrait Pseudomonas spp. isolated from monocropped wheat (Triticum aestivum) suppress Fusarium root and crown rot. Phytopathology. 2020;110:582-592.
- [Google Scholar]