10.2
CiteScore
3.6
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
ABUNDANCE ESTIMATION IN AN ARID ENVIRONMENT
Case Study
Correspondence
Corrigendum
Editorial
Full Length Article
Invited review
Letter to the Editor
Original Article
Research Article
Retraction notice
REVIEW
Review Article
SHORT COMMUNICATION
Short review
7.2
CiteScore
3.7
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
ABUNDANCE ESTIMATION IN AN ARID ENVIRONMENT
Case Study
Correspondence
Corrigendum
Editorial
Full Length Article
Invited review
Letter to the Editor
Original Article
Research Article
Retraction notice
REVIEW
Review Article
SHORT COMMUNICATION
Short review
View/Download PDF

Translate this page into:

Original article
31 (
2
); 194-201
doi:
10.1016/j.jksus.2017.12.013

Assessment of the Genetic Diversity of Apple (Malus × domestica Borkh.) Cultivars Grown in the Kashmir Valley using Microsatellite Markers

Cytogenetics and Plant Breeding Laboratory, Department of Botany, University of Kashmir, Hazratbal Srinagar 190006, India
Plant Genomics Laboratory, School of Biotechnology, University of Jammu, Jammu 180006, India

⁎Corresponding author. jahangirdar53@gmail.com (Jahangir Ahmad Dar)

Disclaimer:
This article was originally published by Elsevier and was migrated to Scientific Scholar after the change of Publisher.

Peer review under responsibility of King Saud University.

Abstract

The diverse germplasm of any crop species represents an important genetic resource for mining genes or alleles necessary to meet future nutritional and disease resistance needs. A total of 29 SSR markers were used to elucidate genetic diversity among nineteen apple cultivars for the first time in the Kashmir valley. Different parameters like polymorphic information content, resolving power and marker index were calculated. A total of 218 polymorphic fragments were obtained. A high level of genetic diversity was observed in these 19 cultivars with 218 polymorphic fragments, between three and 14 alleles per primer pair, averaging 7.51 alleles per SSR. Cultivars differentiated through mutations like Oregon Spur, Reeka Red and Siliver Spur were also used as experimental cultivars in the present study and had identical allelic compositions at all loci. The cluster dendrogram and principal component analysis partitioned the cultivars into two main clusters based on Jaccard’s similarity coefficient. These findings will have impact on apple breeding and conservation programs as the present sample of apple cultivars are commercially very important at national and international level. So their characterization at morphological, biochemical, cytological and molecular level will help the apple breeders to use these in apple breeding.

Keywords

Apple germplasm
Genetic diversity
Kashmir Valley
SSR markers
1

1 Introduction

Apple is an important fruit crop in Kashmir Valley and ranks first in production as well as export among all the fruits in the region (hortikashmir.gov.in). It is one of the four most important fruit crops after citrus, grapes and banana, and one of the commercially most important horticultural crops in the temperate parts of the world (O’Rourke, 2003). Apple varieties are grown throughout the world including Central and West Asia, India, Western provinces of China, Europe and parts of America and Africa (Juniper et al., 1999). In India, apple is mainly grown in Jammu and Kashmir (the leading area), Himachal Pradesh, Uttarkhand, Arunachal Pradesh and Nagaland.

The cultivated apple in Kashmir is comprised of different groups of cultivars such as Delicious, Ambri, and Trel etc. In each type one or few cultivars are only commercially successful e.g. Kashmiri Ambri, American Trel, and Red Delicious etc. The rest of the cultivars in each group are sold in the market under the trade name of well-known cultivars. The monoculture of a few cultivars like Red Delicious, Kullu Delicious, Golden Delicious, American etc. associated with other constraints in the state like Apple Scab, Alternaria, Powdery Mildew and lack of cold chain storage have resulted in loss of diversity and depletion of indigenous apple germplasm and a number of apple cultivars are at the brink of extinction (Bhat et al., 2011). It is therefore important to characterize cultivars of each group so that well known cultivars are clearly distinguished from less known and commercially unsuccessful cultivars. The new cultivars with better characteristics could be identified and promoted to commercial level. The objective of this work was to analyze the genetic diversity of 19 apple cultivars in Kashmir with special reference to Ambri and Delicious cultivars using molecular markers. The information generated will help unambiguously to identify cultivars from each other.

Different types of molecular markers like RAPD, SSR, ISSR, AFLP, RFLP etc. have been used to assess the genetic diversity in crop species. The choice of the technique depends upon the objective of the study, financial constraints, skills and available facilities (Kafkas et al., 2008; Pavlovic et al., 2012). Among the different types of molecular markers, microsatellites have proved to be more reliable for DNA fingerprinting due to co-dominant inheritance, high polymorphism, abundance (Fernandez et al., 2009), reproducibility and relative ease of analysis (Schlotterer, 2004). SSR markers have been used to identify and determine genetic diversity and relationships among Malus × domestica accessions (Gasi et al., 2010; Patzak et al., 2012). Fougat (1984) and Raina (1989) characterized apple germplasm of Kashmir valley on the basis of morphology and cytology whereas Najar (2007) evaluated some apple germplasm of Kashmir Valley by ISSR based molecular markers. In the present study, SSR markers were used for the first time to identify and assess genetic diversity of apple germplasm from the Kashmir Valley.

2

2 Materials and methods

A total of nineteen apple cultivars (Table 1) were selected for the present study on the basis of high commercial importance in the apple market. They are sold at very high price and are also exported outside of the state to India and consist of the ’Delicious’ (indicated by D) and the ‘Ambri’ (indicated by A) groups. These cultivars were identified in private orchards and at the Govt. horticultural Nurseries of Kashmir. A single tree of each cultivar was selected and labeled with an accession number for collection of leaf samples for DNA extraction.

Table 1 Apple cultivars, codes, geo-coordinates, accession numbers, collection sites and districts of investigated cultivars.
Cultivar Code Latitude Longitude Accession No. Collection Site District
Red Delicious D1 34°02′N 74°53ʹE RED DEL ZOU Zoura Srinagar
Kullu Delicious D2 33° 57′N 74° 30′E KUL DEL HAR Hardu suresh Budgam
Shimla Delicious D3 34° 15′N 74° 83′E SHIDEL ZAK Zakura Srinagar
Golden Delicious D4 34° 09′N 74° 33′E GOL DEL ZAN Zangam Pattan Baramullah
Cross Delicious D5 34°02ʹN 74°53ʹE CRO DEL ZOU Zoura Srinagar
Molies Delicious D6 34° 18′N 74° 83′E MOL DEL HOD Hodura Gandarbal
Gole Delicious D7 34°18ʹN 74° 86ʹE GOL DEL WAD Wadimohalla Srinagar
Balgarian Delicious D8 34° 18′N 74° 83′E BALDEL BAK Bakura Ganderbal
Oregon Spur D9 34° 09′N 74° 33′E ORE SPU ZAN Zangam pattan Baramullah
Reeka Red D10 33° 72′N 74° 82′E REE RED DAS Dashpora Shopian Shopian
Siliver Spur D11 34° 09′N 74° 33′E SIL SPUZAN Zangam Pattan Baramullah
Kashmiri Ambri A1 34°02ʹN 74°53ʹE KAS AMB ZOU Zoura Srinagar
Lal Ambri A2 34°02ʹN 74°53ʹE LAL AMB ZOU Zoura Srinagar
Ambri Cross A3 34°02ʹN 74°53ʹE AMB CRO ZOU Zoura Srinagar
Balgarian Ambri A4 33° 72′N 74° 82′E BAL AMB SHO Shopian Shopian
Vilayati Ambri A5 34° 09′N 74° 33′E VIL AMB ZAN Zangam pattan Baramullah
Delicious Ambri A6 33° 72′N 74° 82′E DEL AMB SHO Shopian Shopian
Dudh Ambri A7 34°02ʹN 74°53ʹE DUD AMB ZOU Zoura Srinagar
High Density Ambri A8 33° 72′N 74° 82′E HIG AMB SHO Shopian Shopian

2.1

2.1 DNA extraction and purification

DNA was isolated from young leaf samples using the cetyl trimethyl ammonium bromide (CTAB) protocol of Doyle and Doyle (1990). The extracted DNA was treated with RNase to remove the RNA. The DNA quantity was estimated after separation in 0.7% agarose gel stained with ethidium bromide in the presence of different known concentrations of lambda (λ) DNA. The final concentration of all the DNA samples was adjusted to50 ng µl−1 for subsequent PCR.

2.2

2.2 SSR analysis

For SSR analysis, PCR reaction mixture was prepared in 200 µl tubes. Final concentrations of the reagents were as follows: 1x PCR buffer, 1.5 mM MgCl2, 200 µM of each dNTP, 0.5 µM of each primer, 1 unit of taq DNA polymerase 5 U/µl and ultrapure water to reach the final volume of 20 µl. The volume of DNA used as template was 1.5 µl. PCR program was set as follows- initial denaturation: 95 °C for 5 min; denaturation: 95 °C for 30 s; annealing: 55 °C for 30 s; elongation: 72 °C for 60 s; repetition: 35 cycles. The last step was a final extension of 72 °C for 10 min.

The fluorescently-labeled PCR products were mixed with 0.3 µl of Gene Scan-500 ROX size standard (Applied Biosystems) and 12 µl of Hi-Di Formamide (Applied Biosystems) and separated by capillary electrophoresis on an ABI PRISM 3100. The experiment was replicated at least three times to verify the reproducibility of markers. The amplified fragments were scored with GeneScan 3.7 and Genotyper 3.7 software (Applied Biosystems) as 1 for presence and 0 for the absence of allele.

2.3

2.3 Data analysis

The following parameters were considered for each assay unit as described by Zargar et al. (2016); Number of polymorphic alleles (NPA); Number of monomorphic alleles (NMA); Fraction of polymorphic loci (β) = NPA/(NPA + NMA); Effective multiplex ratio (EMR) = nβ, where n is the total number of bands and β is the fraction of polymorphic loci;

Polymorphic information content (PIC) = 2fi (1-fi), where fi is the frequency of present bands and 1-fi is the frequency of absence bands;

Marker index (MI) = PIC × EMR; Resolving power (RP) = ∑Ib, where Ib can be calculated by the formula as Ib = 1- [2 × (0.5-p)], where p is the frequency of individual band present.

The scored binary data generated from SSR with present alleles scored as 1 and absent alleles as 0 was used for the construction of dendrogram by Jaccard’s similarity coefficient using NTSYS- pc version 2.02e (Rohlf, 1998). The principal component analysis was also performed to differentiate the cultivars. (See Fig. 1)

Map of Kashmir Valley showing collection sites of apple cultivars. Source: SOI Toposheet 1971.
Fig. 1 Map of Kashmir Valley showing collection sites of apple cultivars. Source: SOI Toposheet 1971.

3

3 Results

In the present study a highly informative set of 29 SSR primers (Table 2) was used to distinguish 19 apple cultivars from Kashmir valley. A total of 218 alleles were obtained by 29 SSR primers. The allele number for each primer varied from 3 (Hi06f09) to 14 (Hi08f12) with a mean number of 7.51 alleles per primer (Table 2). In general the size of the amplified DNA fragments scored ranged from 96 to 362 bp. The largest number of alleles was generated by Hi08f12 (14 alleles) followed by Hi05d10, CH03h06 and CH04f04 (13 alleles each). Primer pairs Hi06b06, CH03b01, CH04f03 and CH04f07 produced 10 alleles each in all the nineteen apple cultivars. On the other hand, the minimum number of alleles was amplified by Hi06f09 (3 alleles) followed by Hi08h03, Hi08a04, Hi11a01, Hi23d03 and CH04C03, each amplified 4 alleles in all the cultivars. In order to identify the most efficient primers that could distinguish all the cultivars either individually or in combination, three different indices like Polymorphic Information Content (PIC), Markers Index (MI) and Resolving Power (RP) were applied in the present study (Table 2). Allelic composition for each cultivar is presented in Table 3.

Table 2 SSR primers with various parameters revealing the discriminatory power of each primer.
Primer Forward sequence (5′–3′) Allele Range NA NPA PIC MI RP
Hi05c06 F ATTGGAACTCTCCGTATTGTGC 143–183 5 5 0.45 2.25 2.319
R ATCAACAGTAGTGGTAGCCGGT
Hi05d10 F AATGGGTGGTTTGGGCTTA 147–362 13 13 0.31 4.03 5.263
R GTTTCTTTGGCTATTAGGCCTGC
Hi06f09 F AACCAAGGAACCCACATCAG 290–297 3 3 0.48 1.44 1.265
R GTTTCACTTACACACGCACACACG
GD147 F TCCCGCCATTTCTCTGC 158–172 8 8 0.32 2.56 3.269
R GTTTAAACCGCTGCTGCTGAAC
Hi08h03 F GCAATGGCGTTCTAGGATTC 150–172 4 4 0.37 1.48 1.897
R GGTGGTGAACCCTTAATTGG
Hi02a07 F TTGAAGCTAGCATTTGCCTGT 129–300 8 8 0.19 1.52 1.894
R TAGATTGCCCAAAGACTGGG
Hi01c06 F TTAGCCCGTATTTGGACCAG 144–163 5 5 0.40 2.00 3.241
R GTTTCACCTACACACACGCATGG
Hi06b06 F GGTGGGATTGTGGTTACTGG 171–283 10 10 0.27 2.70 3.473
R GTTTCATCGTCGGCAAGAACTAGAG
Hi02d11 F GCAATGTTGTGGGTGACAAG 210–275 6 6 0.33 1.95 3.157
R GTTTGCAGAATCAAAACCAAGCAAG
Hi08c05 F TCATATAGCCGACCCCACTTAG 173–265 9 9 0.34 3.06 4.315
R GTTTCACACTCCAAGATTGCATACG
Hi08a04 F TTGTCCTTCTGTGGTTGCAG 178–266 4 4 0.46 1.84 1.371
R GTTTGAAGGTAAGGGCATTGTGG
Hi08f12 F GGTTTGTAACCCGTCTCTCG 129–235 14 14 0.22 3.08 3.894
R GTTTCGTAGCTCTCTCCCGATACG
Hi08e06 F GCAATGGCGTTCTAGGATTC 150–184 5 5 0.36 1.80 3.055
R GTTTGGCTGCTTGGAGATGTG
Hi23b12 F TGAGCGCAATGACGTTTTAG 157–222 6 6 0.21 1.26 2.21
R GTTTCAGGCTTTCCCTTCAGTGTC
Hi11a01 F ACCGCCAAATGCTTTGTTAC 227–240 4 4 0.45 1.80 2.002
R GTTTCCTCCATTAAACTCCTCAGTG
AU223486-SSR F TGACTCCATGGTTTCAGACG 222–228 5 5 0.36 1.80 2.424
R AGCAATTCCTCCTCCTCCTC
Hi23d02 F CCGGCATATCAAAGTCTTCC 174–234 4 4 0.42 1.68 2.423
R GTTTGATGGTCTGAGGCAATGGAG
CH03b01 F ACAAGGTAACGTACAACTCTCTC 158–234 10 10 0.29 2.90 3.684
R GTCACAAAACCGCCAGATG
U78948-SSR F GATCGTCCGCCACCTTAAT 231–265 6 6 0.39 2.34 2.53
R AGGGTTTTCATCATGCACATT
CH03ho6 F TTGTCCCTTTTTACGTCTTTCC 163–191 13 13 0.26 3.38 4.210
R GTTATTGAGCAAGGCGGAGA
CH02e12 F CCAACTTTTTCTGCGGTAGTG 178–234 9 9 0.25 2.25 2.842
R TGGGACCCATATGGTTGAATAC
CH04C03 F TGCACACCAAACACAGGACT 212–246 4 4 0.42 1.68 2.423
R TATCAAACATTGGGGCACTG
CH04a06 F AGAAAATCTAAGAGCAGCAG 123–252 8 8 0.29 2.32 2.947
R TAAAACTCAAGTCGCCCGTC
CH04d11 F ATTAGGCAATACACAGCAC 110–163 8 8 0.26 2.08 2.441
R GCTGCTTTGCTTCTCACTCC
CH04d08 F AATTCCACATTCACGCATCT 131–159 8 8 0.32 2.56 3.473
R TTGAAAGACGGAAACGATCA
CH04F03 F CTTGCCCTAGCTTCAAATGC 177–207 10 10 0.30 3.00 2.894
R TCGATCCGGTTAGGTTTCTG
CH04e12 F CCTGAAATCTGCACAACTACCA 242–251 6 6 0.34 2.04 2.425
R GGTGGTGAAGAAGTAGACAGCC
CH04F07 F CAGATCATGAATGATTGAAA 96–202 10 10 0.22 2.20 2.631
R GAAAATCACACCCTCAAACCAT
CH04F04 F GTCGGTCACAACTCAGGACC 166–240 13 13 0.25 3.25 4.105
R CGACGTTCGATCTTCCTCTC
Average/primer 7.51 7.51 0.32 2.28 2.89

NA: Number of alleles; NPA: Number of polymorphic alleles; PIC: Polymorphic information content; MI: Marker index; RP: Resolving power

Table 3 Allelic composition of nineteen apple cultivars amplified by 19SSR primer pairs.
Primer D1 D2 D3 D4 D5 D6 D7 D8 D9 D10 D11
Hi05c06 173,178 173,178 173,178 173,183 173,178 173,183 173 173,183 173,178 173,178 173
Hi05d10 260,270,357,362 268,270,338,362 268,270,338,362 229,339 246,268,338,362 339 246,260,357 229,339 268,338 268,270,338,362 268,270
Hi06f09 297 297 297 290,297 291,297 290,297 291 297 297 297 297
GD147 158 158,172 158,172 158,160 162,172 158,170 158,162 158,168 Nil 158 Nil
Hi08h03 172 172 172 171 172 171 172 171 172 172 172
Hi02a07 300 Nil Nil 129,135 277 129,131,133 277 133 Nil Nil Nil
Hi01c06 145,163 145,163 145,163 160 145,163 144,156,160 163 160 145,163 145,163 145,163
Hi06b06 252,275 258,275 258,275 251 252,258 251,270 252 251 258,275 258,275 258,275
Hi02d11 215,275 265,275 265,275 214 215,275 210 215,261 214 265,275 265,275 265,275
Hi08c05 247,257 247,251,257 247,251,257 253,265 247,257 256 247,251 250,256 251,257 247,251,257 247,251,257
Hi08a04 263,266 263 263 263,266 263 263 263,266 263,266 263 263 Nil
Hi08f12 159 159,172 147,159,172 129 162,172 129,231 159,162 145 147,159,172 147,159,172 159,172
Hi08e06 151,172 151,172 151,172 150 151,172 150 151,172 150 151,172 151,172 151,172
Hi23b12 157 159 159 170 Nil 170 186 157,170 159 159 159
Hi11a01 231,234 234 234 231,234,240 234,240 234 231,234 231,240 234 234 234
AV223486-SSR 223,227 227 227 222,225 223,227 222 223 225 227 227 227
Hi23d02 231,234 234 234 174,180 234 174 231,234 174 234 234 234
CH03b01 158,172,180,198 158,198 158,198 179 180,198 179,181 180 177,183 158,198 158,198 158,198
U78948-SSR 231,234 234 234 262,265 234,263 262 231,234 262,265 234 234 234
CH03ho6 174,184 174,190 174,190 163,173,183 170,172,174 173,191 180,182,184 163,183 174,190 174,190 174,190
CH02e12 180,218 180 180 178 180,218 208,216 218 214 180 180 180
CH04C03 215 215 215 212 215 212 215 212,214 215 215 215
CH04a06 124 124 124 123,125 124,142 123,141 128,142 123 124 124 124
CH04d11 155 155 155 154 155 110,154 143,155,160 147 155 155 155
CH04d08 148 131,148 131,148 142,152 131,159 132,152 152 132,154 131,148 131,148 131,148
CH04F03 202 202,204 202,204 201,207 193,202 201,203 177,202 195,201 202,204 202,204 202,204
CH04e12 243 243 243 242,246 243,251 242 243,251 246,250 243 243 243
CH04F07 124 124,159 124 104,112 124 110,112 178,202 96 124 124 159
CH04F04 167,180,218 180,234 180 166,178 180,218 184,208 167,218,231,234 166 180,185 180,185 180,185,234
Primer A1 A2 A3 A4 A5 A6 A7 A8
Hi05c06 173,178 173,183 145,178 143,178 173,178,183 173,183 173,183 183
Hi05d10 240,256,338 229,339 151,160,270,338 147,256,268,338 256,268,338 339 339 339
Hi06f09 291 297 291,297 297 291,297 290,297 290 297
GD147 162,166 158,168 166,172 158,168 162,166,172 166,172 162,166 158,168
Hi08h03 172 150 158 158 172 171 Nil 171
Hi02a07 277 129,133 Nil 263 298 135 131,135 133
Hi01c06 163 160 145,163 163 145,163 144,160 160 160
Hi06b06 252,283 251,276 171,272 171,275 252,275 251,274 251 251
Hi02d11 215 214 215,265 215,275 215 214,262 214 214
Hi08c05 247,251,257 250,256 173,251,257 173,282 251 250 256 250,256
Hi08a04 263,266 263,266 180,266 178 263,266 263,266 263,266 263,266
Hi08f12 162,166 145 180,176 182,168,176 166,172 145,235 145 145
Hi08e06 151,155,172 150 184,172 184,172 151,155,172 150,154 150,154 150
Hi23b12 159 157,170 222 222,172 159 157 170 170
Hi11a01 234 231,240 227 227 231,234 234 234 231,240
AV223486-SSR 223,227 225 Nil 228,227 227 225 222,225 225
Hi23d02 234 174 Nil 231 231,234 174,180 174,180 174
CH03b01 180 177,183 234,180 234,180 158,180,198 179,197 179 Nil
U78948-SSR 234 262,265 234 231,240 234 262,265 262,265 Nil
CH03ho6 172,182 163,183 174,182 164,184 172,174,182 173,181 171,183 163,183
CH02e12 216 214 180,216,234 208,210,216,218 180,216 178 214 204
CH04C03 215 212,214 246 246 215 212,214 212,214 212,214
CH04a06 142 123 251,128,142 252,126 124,142 123,141 141 123
CH04d11 143,155 147 163 163 143,155 154 154 147
CH04d08 159 132,152 148,159 133 148,159 148,158 158 132,154
CH04F03 177,193 195,201 177,204 197 177,202,204 177,203 177,191 195,201
CH04e12 243,251 246,250 243 243 243 242 242,250 246,250
CH04F07 124 96 124 197,202 159 96,122 96 96
CH04F04 216,234 166 180,185,216 167,216,231,240 180,234 178 214 166

D1-Red Delicious, D2-Kullu Delicious, D3- Shimla Delicious, D4-Golden Delicious, D5-Cross Delicious, D6-Molies Delicious, D7-Gole Delicious, D8-Balgarian Delicious, D9-Oregon Spur, D10-Reeka Red, D11- Siliver Spur

A1-Kashmiri Ambri, A2-Lal Ambri, A3-Ambri Cross, A4- Balgarian Ambri, A5-Vilayati Ambri, A6- Delicious Ambri, A7-Dudh Ambri, A8-High Density Ambri

3.1

3.1 Cultivar relationships based on SSR analysis

The UPGMA separated the apple cultivars into two main clusters (Fig. 2). Cluster I consisted of twelve cultivars while the remaining seven of the cultivars were found in cluster II. Both the clusters were divided into sub clusters. The ‘Red Delicious’ sub-group consisted of six cultivars: Red Delicious, Kullu Delicious, Shimla Delicious, Reeka Red, Oregon Spur and Siliver Spur. Kullu Delicious, Shimla Delicious had the same allele composition at all SSRs while ‘Reeka Red’ was closely related with difference at two of the 29 SSRs. Cross Delicious, Kashmiri Ambri and Vilayati Ambri also grouped together in a separate sub-cluster. In cluster II, two small sub-clusters were again formed. The Golden Delicious sub-cluster consisted of Golden Delicious, Molies Delicious, Delicious Ambri and Dudh Ambri whereas the remaining three cultivars, Balgarian Delicious, Lal Ambri and High Density Ambri formed the second sub-group within cluster II. The Jaccard’s similarity coefficient based on SSR data ranged from 0.05 to 0.93. (Fig. 2). The three cultivars: Oregon Spur (D9), Reeka Red (D10) and Siliver Spur (D11) which are said to be sports of Red Delicious were different from each other and grouped together with Kullu Delicious (D2) and Shimla Delicious (D3) in one sub cluster.

UPGMA cluster analysis based on Jaccard’s similarity coefficient. D1-Red Delicious, D2-Kullu Delicious, D3-Shimla Delicious, D4-Golden Delicious, D5-Cross Delicious, D6-Molies Delicious, D7-Gole Delicious, D8-Balgarian Delicious, D9-Oregon Spur, D10-Reeka Red, D11-Siliver Spur, A1-Kashmiri Ambri, A2-Lal Ambri, A3-Ambri Cross, A4-Balgarian Ambri, A5-Vilayati Ambri, A6-Delicious Ambri, A7-Dudh Ambri, A8-High Density Ambri.
Fig. 2 UPGMA cluster analysis based on Jaccard’s similarity coefficient. D1-Red Delicious, D2-Kullu Delicious, D3-Shimla Delicious, D4-Golden Delicious, D5-Cross Delicious, D6-Molies Delicious, D7-Gole Delicious, D8-Balgarian Delicious, D9-Oregon Spur, D10-Reeka Red, D11-Siliver Spur, A1-Kashmiri Ambri, A2-Lal Ambri, A3-Ambri Cross, A4-Balgarian Ambri, A5-Vilayati Ambri, A6-Delicious Ambri, A7-Dudh Ambri, A8-High Density Ambri.

The UPGMA cluster analysis revealed that some Ambri and Delicious cultivars form a separate subgroup. There are no possible reasons as the present study is just a preliminary survey in which only 19 cultivars and 29 SSR primers were used. The limited number of primers has generated little information. So the use of maximum number of primers to cover most of the linkage groups can provide more and more information. As such we can not say that the Ambri apple cultivars have developed from Delicious group due to some hybridizations events taking place in the orchards because there is no literature available regarding the origin of most of Ambri as well as Delicious cultivars. It may be possible that some Ambri cultivars would have been developed from Delicious by natural hybridisation events in the orchards.

PCA also supported the groups obtained with cluster analysis. Most of the Delicious cultivars grouped together along with few cultivars from the Ambri group. Five cultivars from the Delicious group namely Kullu Delicious (D2), Shimla Delicious (D3), Reeka Red (D10), Oregon Spur (D9) and Siliver Spur (D11) formed a separate group at one corner in PCA plot, thus indicating close similarity to each other. On the other hand, the second group consisted of seven cultivars which include Kashmiri Ambri (A1), Gole Delicious (D7), Ambri Cross (A3), Balgarian Ambri (A4), Vilayati Ambri (A5), Cross Delicious (D5) and Red Delicious (D1). The third group also was comprised of seven cultivars which includes Molies Delicious (D6), Golden Delicious (D4), Delicious Ambri (A6), Dudh Ambri (A7), High Density Ambri (A8), Lal Ambri (A2) and Balgarian Delicious (D8) (Fig. 3).

3D PCA plot of apple cultivars.
Fig. 3 3D PCA plot of apple cultivars.

4

4 Discussion

Assessment of genetic diversity within a cultivated crop has important consequences in breeding and the conservation of genetic resources. Several molecular markers have been used widely for the analysis of genetic diversity and cultivar identification in large number of species. Molecular markers have succeeded in differentiating cultivars, classifying synonyms, identifying mislabeled cultivars, establishing genetic relationships and giving hints about the process of domestication (Anand, 2000; Wunsch and Hormaza, 2002). SSR markers are the preferred DNA markers for the analysis of genetic relationships and diversity within crop species due to their high polymorphism level, abundance, co-dominant inheritance (Fernandez et al., 2009), reproducibility and relative ease of analysis (Schlotterer, 2004). Hundreds of microsatellite markers have been developed in apple and some have been placed on genetic linkage maps (Liebhard et al., 2002; Silfverberg-Dilworth et al., 2006). Microsatellites have been also used as markers to predict important traits like resistance to apple scab (Vinatzer et al., 2004).

In the present investigation SSR data for 19 apple cultivars revealed a total of 218 polymorphic fragments with 29 primer pairs. The mean number of alleles per primer obtained was 7.51 which is similar to the results reported earlier by different groups (Wichmann et al., 2007; Pereira-Lorenzo et al., 2007). Gasi et al. (2010) selected ten genomic SSRs to assess genetic diversity in 39 cultivars of apple and reported that the average number of alleles per SSR is 10.4. Gao et al. (2007) analyzed 59 apple cultivars using 12 SSRs and detected an average of 14.7 alleles per primer. The higher average number of alleles per SSR primer may be attributed to multi allelic nature of SSR primers. The multi allelic SSRs produce more than two alleles even in diploid cultivars. Multi locus SSRs indicates how many alleles are present in the genome. There is nothing like triploid and tetraploid nature of these cultivars as the present samples were analysed based on cytology which proved all these cultivars diploid with 2n = 34.

Marker indices like PIC, MI, RP etc. are informative parameters to detect the levels of genetic diversity in an organism. In the current study, the primers with highest marker indices values will help in the screening of genetic polymorphism among apple cultivars. The respective values for each informative index have been reported in Table 2. It is anticipated that these primers would help apple researchers to pick up and conduct further downstream studies related to genetic amelioration.

Allelic compositions of most of the primer pairs have proved that Kullu Delicious and Shimla Delicious resemble the three sports (Oregon Spur, Reeka Red and Siliver Spur) investigated in the present study. By screening 29 SSR primers for their informativeness, the present study demonstrates that four primers Hi05d10, Hi08c05, CH03h06 and Ch04F04 have highest resolving power i.e. these detect enough base pair variation among nineteen apple cultivars to allow their distinction. Due to close interrelationships and narrow gene pool of the accessions in this study, additional markers/primers will be needed to fully characterize and distinguish a large set of cultivars. This study will enable us to identify a standard set of primers that can be used to distinguish the apple germplasm of our state.

5

5 Conclusion

The purpose of our study was to assess the genetic diversity of the apple germplasm of Kashmir Valley. SSR analysis based on 29 primer pairs have separated the cultivars of Delicious group and it was also found that Kullu Delicious and Shimla Delicious resemble in allelic composition with the sports like Oregon Spur, Reeka Red and Siliver Spur. All the observations made in this study will provide valuable evidence for decision making in choosing of markers for future work, characterization of germplasm, breeding and apple germplasm management.

Acknowledgements

The authors are highly thankful to Department of Biotechnology, Government of India for providing financial assistance as a part of the project entitled “Creating a Genomics Platform for Apple Research in India” vide no. DBT/PR/11040PBD/16/812/2008 dated on June 4, 2010. Dr. Sajad M. Zargar is highly acknowledged for assisting in statistics. We would like to thank to Director Horticulture, Kashmir Division for necessary permissions during field surveys. Thanks are also due to Mr. Manzoor Ahmad Bhat Pomology Expert for his unconditional help during field surveys.

Compliance with ethical standards.

Conflict of interest

All the authors declare that they have no conflict of interest.

References

  1. Anand, L., 2000. Molecular markers and their application in horticultural crops. In: Chadha, K.L., Ravindran, P.N., Sahijran (eds) Biotechnology in horticultural and plantation crops. Malhotra Publishing House, New Delhi.
  2. , , , , . Effect of interstock on juvenility and tree size of ambri apple. Acta Hortic.. 2011;903:435-437.
    [Google Scholar]
  3. , , . A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull.. 1990;19:11-15.
    [Google Scholar]
  4. , , , , , , . Genetic diversity in Spanish and foreign almond germplasm assessed by molecular characterization with simple sequence repeats. J. Am. Soc. Horticultural Sci.. 2009;134:535-542.
    [Google Scholar]
  5. Fougat, R.S., 1984. Assessment of the germplasm of apple grown in Kashmir Valley. Ph.D. Thesis. University of Jammu, India.
  6. , , , , . Analysis of genetic relationship for Malus germplasm resources by SSR markers. J. Fruit Sci.. 2007;24:129-134.
    [Google Scholar]
  7. , , , , , . Genetic assessment of apple germplasm in Bosnia and Herzegovina using microsatellite and morphologic markers. Scientia Horticulturae. 2010;126:164-171.
    [Google Scholar]
  8. http///hotrtikashmir.gov.in
  9. , , , . The origin of the apple. Acta Hortic.. 1999;484:27-33.
    [Google Scholar]
  10. , , , , , , . Molecular characterization of mulberry accessions in Turkey by AFLP markers. J. Am. Soc. Hortic. Sci.. 2008;4:593-597.
    [Google Scholar]
  11. , , , , , , , . Development and characterisation of 140 new microsatellites in apple (Malus × domestica Borkh.) Mol. Breed.. 2002;10:217-241.
    [Google Scholar]
  12. Najar, M.A., 2007. Molecular Characterization of Apple (Malus pumila Mill.) cultivars of Kashmir using DNA based markers. M. Phil. Dissertation, Dept. of Botany, University. Kashmir, Kashmir.
  13. , . World production, trade, consumption and economic outlook for apples. In: , , eds. Apples: botany, production, and uses. CAB international, UK: CABI publishing; . p. :15-28.
    [Google Scholar]
  14. , , , , . Genetic diversity of Czech apple cultivars inferred from microsatellite markers analysis. Hortic. Sci.. 2012;39(4):149-157.
    [Google Scholar]
  15. , , , , , , , . Characterization of onion genotypes by use of RAPD markers. Genetika. 2012;2:269-278.
    [Google Scholar]
  16. , , , . Evaluation of genetic identity and variation of local apple cultivars (Malus × domestica Borkh.) from Spain using microsatellite markers. Genet. Resour. Crop Evol.. 2007;54:405-420.
    [Google Scholar]
  17. Raina, R., 1989. Germplasm assessment of apple (Malus pumila Mill.) cultivars of Kashmir Valley. M. Phil. Thesis, University of Jammu, Jammu.
  18. Rohlf, M., 1998. NTSYS-pc: numerical taxonomy and multivariate analysis system. Version 2.2. Dept. of Ecology and Evolution. State University of New York.
  19. , . The evolution of molecular markers— just a matter of fashion? Nat. Rev. Genet.. 2004;5:63-69.
    [Google Scholar]
  20. , , , , , , , , , , , , , , . Microsatellite markers spanning the apple (Malus × domestica Borkh.) genome. Tree Genet. Genomics. 2006;2:202-224.
    [Google Scholar]
  21. , , , , , , . Isolation of two microsatellite markers from BAC clones of the Vf scab resistance region and molecular characterization of scab-resistant accessions in Malus germplasm. Plant Breed.. 2004;123:321-326.
    [Google Scholar]
  22. , , , , , , , . Molecular identification of old Hungarian apple varieties. Int. J. Hortic. Sci.. 2007;3:37-42.
    [Google Scholar]
  23. , , . Cultivar identification and genetic fingerprinting of temperate fruit tree species using DNA markers. Euphytica. 2002;125:59-67.
    [Google Scholar]
  24. , , , , , . Unraveling the efficiency of RAPD and SSR markers in diversity analysis and population structure estimation in common bean. Saudi J. Biol. Sci.. 2016;23:139-149.
    [Google Scholar]
Show Sections