7.9
CiteScore
 
3.6
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
ABUNDANCE ESTIMATION IN AN ARID ENVIRONMENT
Case Study
Correspondence
Corrigendum
Editorial
Full Length Article
Invited review
Letter to the Editor
Original Article
Research Article
Retraction notice
REVIEW
Review Article
SHORT COMMUNICATION
Short review
7.2
CiteScore
3.7
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
ABUNDANCE ESTIMATION IN AN ARID ENVIRONMENT
Case Study
Correspondence
Corrigendum
Editorial
Full Length Article
Invited review
Letter to the Editor
Original Article
Research Article
Retraction notice
REVIEW
Review Article
SHORT COMMUNICATION
Short review
View/Download PDF

Translate this page into:

Research Article
ARTICLE IN PRESS
doi:
10.25259/JKSUS_594_2025

Analysis of TP53 gene in breast cancer and comparison with the canine counterparts

Laser Research Centre, Faculty of Health Sciences, University of Johannesburg, P.O. Box 1711, Doornfontein 2028, South Africa
Department of Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Lahore, 54000, Pakistan

*Corresponding author: E-mail address: blassang@uj.ac.za (B P. George)

Licence
This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-Share Alike 4.0 License, which allows others to remix, transform, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.

Abstract

Cancer is marked by uncontrolled cell division with the potential to invade and spread to other tissues. Tumor suppressor genes (TSGs) like Tumor Protein p53 (TP53) are critical for cellular homeostasis, regulating processes such as the cell cycle, DNA repair, and apoptosis. Mutations in TP53 are common in cancers, including breast cancer, disrupting its tumor-suppressing function. This study investigated TP53 nucleotide variants in breast cancer patients from Punjab, Pakistan, to evaluate their impact on protein function and gene regulation. Blood samples were collected from ten breast cancer patients, and DNA was extracted using a standard organic method. DNA quality was assessed using a nanodrop spectrophotometer, and TP53 regions were amplified with specific primers for sequencing. Sequencing results were analyzed using bioinformatics tools: Chromas and bioedit for sequence visualization and editing, basic local alignment search tool (BLAST) for alignment with reference sequences, and Mutation Tester for identifying novel and known single nucleotide polymorphisms (SNPs). Express protein analysis system (EXPASY) compared normal and mutated codon and amino acid sequences, while protter and trrosetta modelled primary and 3D protein structures, respectively, to assess functional changes. The study identified several genetic variations. A cytosine deletion in exon 4 (NM_000546.6:c.528delC) caused a frameshift, producing a truncated protein (NP_000537.3:p.H178Tfs*69) in sample 4. Intron variants included an SNP (NM_000546.6:c.672+62A>G, Rs1625895) in samples 2, 3, 4, and 5, a cytosine deletion (NM_000546.6:c.783-56delC) in samples 2, 4, 5, 6, 7, and 10, and an adenine deletion (NM_000546.6:c.920-32delA, Rs1266367430) in sample 2. While the exon 4 mutation directly impacts protein structure, intronic mutations may influence splicing or gene regulation. Further studies with larger cohorts and transcriptomic or proteomic analyses are required to explore the functional implications of these mutations and their role in breast cancer pathogenesis, potentially revealing new therapeutic targets.

Keywords

Breast cancer
Genetic variation
Mutation
TP53 gene
Tumor suppressor gene

1. Introduction

Tumors are characterized by the abnormal and uncontrolled growth of cells, leading to the formation of masses or lumps. These cells can invade surrounding tissues and potentially spread to other parts of the body through the blood and lymphatic systems. This unregulated growth and potential for metastasis make tumors a significant concern (Hirshfield, Rebbeck and Levine, 2010). Scientists have identified over 200 different types of cancer, each with specific characteristics and levels of severity. These cancers are linked to gene mutations that lead to abnormal cell proliferation. Moreover, genetic disorders passed down through inheritance play a crucial role in promoting the growth of these cells. Understanding these genetic factors is essential in comprehending the complexities of cancer development and progression (Hassanpour and Dehghani, 2017). Breast cancer is a significant and prevalent health concern that poses a serious threat to women’s well-being, leading to substantial mortality rates globally. Numerous risk factors associated with breast cancer have been extensively studied through epidemiological research. These factors include cultural background, family history of the disease, race, genetic predisposition, and various modifiable exposures like excessive alcohol consumption, lack of physical activity, use of exogenous hormones, and certain reproductive factors in women (Coughlin and Cypel, 2013), (Armstrong, Eisen and Weber, 2000). The Global Cancer Observatory (GCO) 2022–2045 report on breast cancer burden projects that the global incidence rate of breast cancer will rise by 68.3%, with the mortality rate expected to increase by 62.8% (Cancer Tomorrow, no date). Approximately 95% of breast malignancies are carcinomas, which are broadly classified into two main types: in situ carcinomas (non-invasive) and invasive carcinomas (which spread beyond the original tissue). In situ carcinomas may arise in either lobular or ductal epithelium but remain confined to their original location without breaking through the basement membrane. This limited growth indicates a low risk, with minimal potential for metastases. However, when lobular or ductal malignancy extends beyond the basement layer, it is considered invasive, leading to an increased risk of metastasis. Additionally, genetic factors, lifestyle choices also play a crucial role in determining breast cancer risk. These lifestyle factors are considered significant determinants in the development of breast cancer (Rojas and Stuckey, 2016). Breast cancer is a complex and challenging disease characterized by alterations in the genes that regulate cell growth and proliferation. Some of the oncogenes implicated in this condition include human epidermal growth factor receptor 2/neuroblastoma (HRE2/neu), kirsten rat sarcoma viral oncogene homolog (K-RAS), cellular myelocytomatosis oncogene (c-MYC), progesterone receptor (PR), and estrogen receptor (ER). On the other hand, certain genes such as TP53, retinoblastoma gene (RB), and phosphatase and tensin homolog (PTEN) play a crucial role in suppressing tumor formation. Additionally, the susceptibility genes like breast cancer gene 1 (BRCA1) and breast cancer gene 2 (BRCA2) are also significantly involved in the development of breast cancer.

The TP53 tumor suppressor gene is located on chromosome 17p13 and consists of eleven Exons. It is responsible for producing a 53-kDa nuclear phosphoprotein, which plays a crucial role in various cellular processes such as cell-cycle control, DNA repair, apoptosis, and gene expression. The multifunctional nature of TP53 protein makes it indispensable for maintaining the integrity and stability of the cell and preventing the formation and progression of tumors (Al-hamadawi, Al-Janabi and Al-bider, 2016). TP53 is the most frequently mutated gene in various common human diseases, and it is estimated that mutations occur in about 50% of all tumors. When these mutations occur, the resulting proteins are impaired in their ability to bind to specific DNA sequences, leading to a reduced capacity to activate genes that are normally regulated by the wild-type (normal) TP53 protein (Bosari and Viale, 1995) (Hussain and Harris, 2000). Research findings from multiple studies have provided substantial evidence supporting the presence of around 20% of breast cancer mutations within the Exon 5-8 region of the TP53 gene. These mutations have been strongly associated with significantly worse patient survival outcomes (Andersen et al., 1993) (Elledge et al., 1993). The TP53 gene undergoes mutations in various types of tumors, with shared transformative monitored codons. The extent of mutation in TP53 varies among lung, breast, liver, throat and brain cancers, hemopoietic, and reticuloendothelial tissues. These mutations have been observed not only in individuals with sporadic tumors but also in families with a predisposition to cancer, even in cases of li-fraumeni syndrome. Previous research suggests that the vast majority, exceeding 98%, of TP53 mutations found in human tumors are likely to be functionally significant alterations (Hollstein et al., 1991).This condition involves a complex interplay of genetic factors that contribute to the growth and progression of breast tumors (Sledge and Miller, 2003).

Addressing these risk factors and raising awareness about breast cancer screening, prevention, and early detection are vital steps in reducing its impact and improving women’s health outcomes. By understanding the complex interplay of factors contributing to breast cancer, healthcare professionals and policymakers can work towards better preventive measures and effective interventions to reduce the burden of this disease on women’s lives (Coughlin, 2019). The incidence and mortality rates of breast tumors in women are essential indicators used to assess the overall burden of this disease, and in some countries, they have been steadily increasing (Coughlin and Ekwueme, 2009). Male breast cancer, although relatively rare, does occur. This disease is less prevalent among men as compared to women (Miao et al., 2011).

The inclusion of dogs in research studies addresses a notable gap in animal models and translational medicine. This is underscored by the fact that dogs exhibit around 400 characterized inherited disorders, many of which are highly relevant to humans. The distinct genetic makeup of dog breeds simplifies disease mapping and pharmacogenomics, aided by their accelerated aging, shared environments, and extensive healthcare, making them valuable models for human disease research with infrastructure developed over the past decade, including the sequencing of the dog genome (Paoloni and Khanna, 2007) (Rowell, McCarthy and Alvarez, 2011).

This study investigated potential alterations in Exon 5 and 7 of the TP53 gene among breast cancer patients in the local population of Punjab, Pakistan. Furthermore, the research seeks to conduct in silico analysis in canines. The selection of these specific exons is based on their association with splice sites linked to tumor progression and development. The primary objective is to uncover novel and reported genetic variation within the TP53 gene, providing valuable insights for supplementing existing databases and advancing our comprehension of tumor progression in humans.

2. Material and Methods

The research was conducted at the Molecular Biology and Biotechnology Laboratory, located in the Institute of Biochemistry and Biotechnology (IBBT) at University of Veterinary and Animal Sciences (UVAS), Lahore, Pakistan.

2.1 Clinical evaluation and patient selection

Initially, a thorough search was conducted to identify families and individuals affected by breast cancer. The selection of breast cancer patients was based on the clinical information provided. These patients underwent careful examination by experienced oncologists to determine their tumor types, which were classified as showed in Table 1.

Table 1. Sample collection and classification.
Age (Years) Sample ID Tumor stage Tumor classification
47 BC1 Bilateral cancer, IV-Right I-Left IDC
40 BC2 I IDC
40 BC3 IV IDC
40 BC4 IV ILC
50 BC5 IV DCIS
40 BC6 IV IDC
34 BC7 III IDC
45 BC8 IV IDC
60 BC9 IV IDC
40 BC10 IV IDC

BC: Breast cancer patients; IDC: Invasive ductal carcinoma; ILC: Invasive lobular carcinoma; DCIS: Ductal carcinoma in-situ.

2.2 Source of sample and storage

Blood samples from ten patients diagnosed with breast cancer by a skilled phlebotomist. The blood was drawn into vacutainer blood collection tubes containing 0.5 M EDTA (ethylene diamine tetra acetic acid) as an anticoagulant. Blood samples were carefully stored at -20°C.

2.3 DNA extraction and genomic DNA estimation

DNA extraction was performed from preserved samples using a well-established method based on the protocol described by Sambrook and Russell, (2006). Following DNA extraction, gel electrophoresis was carried out to analyze polymerase chain reaction (PCR) products, adhering to the method previously outlined in (Hussussian et al., 1994). For DNA quantification, a nanodrop spectrophotometer (nanodrop 2000, thermo Scientific) was used, following the procedure described by Desjardins and Conklin et al. (Desjardins and Conklin, 2010). Initially, the nanoDrop instrument was prepared by placing 1 µL of nuclease-free water onto the pedestal to perform a blank measurement. This blank served as the baseline standard to calibrate the device and eliminate background absorbance. Once the blank was recorded, 1 µL of the extracted DNA sample, dissolved in nuclease-free water, was placed on the nanodrop arm. The sample was then analyzed by selecting the “measure” option on the connected computer, and the DNA concentration and purity were determined based on absorbance at 260 nm and 280 nm. This approach ensured accurate and reliable DNA quantification, critical for downstream molecular analyses.

2.4 Primer designing, synthesis and dilutions

Primer 3 software (https://bioinfo.ut.ee/primer3-0.4.0/) was employed to design primers that targeted the amplification of specific regions within the TP53 gene (Table 2). Specifically, the software was utilized to design primers for the amplification of Exon 5, which spans approximately 371 base pairs, and Exon 7, which encompasses around 299 base pairs of the TP53 gene sequence. This genetic sequence is readily accessible on the National Center for Biotechnology Information (NCBI) platform under the Accession number NC_000017.11. The TP53 gene is situated on chromosome number 17. This approach facilitated the precise targeting of these gene segments for further analysis and experimentation. Exon 5 and Exon 7 primers were synthesized by Gene Link under the brand e-oligos. The primers were obtained in lyophilized form, with concentrations measured in nanomoles. The initial concentration of each primer in stock was 100 picomoles, while the concentration of primers used in the actual experiments was 10 picomoles. The primers were appropriately diluted using a standard dilution method. Primers were checked for self-complementarity through oligocalc: Oligonucleotide properties calculator (http://biotools.nubic.northwestern.edu/OligoCalc.html). To check the specificity and non-specificity of primers, In silico PCR of UCSC (University of California Santa Cruz) genome browser (https://genome.ucsc.edu/) was used forward and reverse primers were put on In silico PCR and click on submit. This method gave amplified product of specific size.

Table 2. Primer design for Exon 5 and 7.
Primer name Sequence length GC% Tm
E-5-F Primer 5’ CCATCTACAAGCAGTCACA 3’ 19 47.37 52.82
E-5-R Primer 5’ AAATAAGCAGCAGGAGAAAG 3’ 20 40.00 54.14
E-7-F Primer 5’ AGGGTGGTTGGGAGTAGA 3’ 18 55.56 55.29
E-7-R Primer 5’ AAGTGAATCTGAGGCATAACTG 3’ 22 40.91 56.15

2.5 PCR optimization

PCR optimization for Exon 5 and Exon 7 was systematically performed by using BIO-RAD T100TM thermal cycler (Serial no. 621BR10685) (Made in Singapore). These optimization steps were carried out on control samples initially. To enhance the PCR conditions, adjustments were made to several factors including the concentration of magnesium ions (Mg2+), deoxyribonucleotide triphosphates (dNTPs), primers, and Taq DNA polymerase. These adjustments were tested across different temperature profiles. The experimental process involved the use of a primer set consisting of forward and reverse primers, Taq DNA polymerase, PCR buffer, dNTPs, MgCl2, genomic DNA as the template, and nuclease-free water. Various conditions were explored to refine the amplification of the target Exons. The initial concentration of the control DNA sample was measured at 194.81 ng/µL, which served as the basis for the optimization of Exon 5 and Exon 7 amplification. Using the optimal concentration determined from the control DNA sample, the patient DNA samples were appropriately diluted. This ensured that the PCR amplification of Exon 5 and Exon 7 could be effectively tailored to specific characteristics of the patient samples.

2.6 Standard PCR of exon 5 and exon 7

The DNA samples underwent amplification using the standard PCR method at a temperature of 62°C. The amplification of Exon 5 and 7 was carried out using the BioRad PCR Thermocycler with both forward and reverse primers. The PCR reaction mixture consisted of a DNA template, forward and reverse primers, a 10X Taq Buffer containing Tris HCl-pH 8.8, (NH4)2SO4, and Tween 20 (provided by Thermo Scientific®), MgCl2 (also from Thermo Scientific®), dNTPs obtained from Thermo Scientific®, and molecular-grade water sourced from Getz Pharma®. The specific conditions for the Standard PCR procedure are mentioned in Fig. 1.

Protocol for standard PCR of exon 5 and 7 primers.
Fig. 1.
Protocol for standard PCR of exon 5 and 7 primers.

The PCR amplified product was subjected to a precipitation protocol for further processing. Initially, all the PCR amplicons were carefully transferred into individual 1.5 mL tubes provided by Biologix Group Limited®. To facilitate precipitation, approximately 100 µL of 80% ethanol sourced from AnalaR® was introduced into each tube, ensuring that the tube lids were closed. The tubes were subsequently shielded from light using aluminum foil from Diamond® as ethanol is known to be most effective under dark conditions. This arrangement was maintained for 30 min at a temperature of 4°C. Following the 30 min incubation, the tubes were unveiled by removing the aluminum foil. To achieve the precipitation step, centrifugation was carried out at 4500 rpm for 20 min of 4°C. The supernatant resulting from centrifugation was carefully discarded, leaving behind a DNA pellet. This pellet was allowed to air dry until the noticeable scent of ethanol from AnalaR® dissipated. To proceed, 15 µL of nuclease-free water supplied by Getz Pharma® was introduced to the dried DNA pellet. With the DNA now resuspended, the subsequent step involved conducting gel electrophoresis. A 1.2% agarose gel was meticulously prepared, and an electrical potential of 110 volts was applied for a duration of 25 min to facilitate the migration of DNA fragments. After the gel electrophoresis process was completed, the gel was transferred to a Biorad Gel Documentation system to captured images for further analysis.

2.7 Sequencing of amplified product

Following the precipitation of the PCR product, the sequencing procedure was initiated, employing the Sanger chain termination, also known as dideoxy termination, method (Sanger, Nicklen and Coulson, 1977). This method relies on several essential components, including DNA polymerase, the target DNA template, fluorescently labelled nucleotides dNTPs, a primer, and modified nucleotides ddNTPs that lead to termination of chain elongation. To accomplish the sequencing, a series of four distinct reactions were set up, each utilizing the same DNA template. Within the sequencing reaction mixture, crucial ingredients encompass the DNA template, DNA polymerase, primers, and the necessary deoxynucleotide triphosphates (dTTP, dATP, dCTP, dGTP). Additionally, dideoxy nucleotide triphosphates (ddTTP, ddATP, ddCTP, ddGTP) were included in each reaction. It is notable that these dideoxy nucleotides (ddNTPs) were characterized by their lack of a 3’OH group, a pivotal element required for the formation of phosphodiester linkages, as emphasized by Sanger et al. (1977) (Sanger, Nicklen and Coulson, 1977). This absence of the 3’OH group in ddNTPs results in the termination of chain elongation due to the inability to form phosphodiester bonds, effectively halting further extension of the DNA strand. For the actual sequencing process, the samples were subjected to analysis using the ABI 3130 XL genetic sequencer/analyzer (Applied Biosystems, Lahore city, Advance Bioscience international Pakistan). The reagents employed in the sequencing reaction are enumerated in Table 3:

Table 3. Sequencing reaction composition.
Sr. No Reagents Quantity
1 Diluted DNA sample 6 µL
2 Big dye sequencing mix 2 µL
3 Primer (3.2) pM 1 µL
4 5X Buffer 1 µL
Total volume 10 µL

Following PCR product sequencing, the samples were precipitated using 75% ethanol, with 40 µl ethanol added to each reaction, resulting in a final concentration of 60%. The mixture was vortexed and left at room temperature for 20 min. Centrifugation was then performed at 14,000 rpm for 20 min at 4°C. After centrifugation, the supernatant was discarded, and the pellet was washed with 100 µl of 70% ethanol. Following washing, the pellet was air-dried at room temperature. Subsequently, 15 µL of deionized formamide was added to each pellet. Denaturation was carried out at 95°C for 5 min, followed by chilling before loading onto the ABI 3130 genetic analyzer. Analysis was conducted using ABI PRISM sequencing analysis software version 3.7. Conditions and protocol are shown in Table 4 below.

Table 4. Conditions and protocol for sequencing.
Steps Temperature Time
Initiation denaturation 95°C 1 min
Denaturation 96°C 30 sec
Annealing 60°C 15 sec
Extension 72°C 4 min
Repeat steps 1 to 3 for 35 cycles
Final extension 72°C 5min

2.8 Data analysis of amplicon

Bioinformatics tools were employed for the comprehensive analysis of the amplified sequences. For manual sequence editing and alignment, bioedit software (Version 7.2.5) was utilized. To analyze nucleotide sequence homology, the NCBI nucleotide (BLAST) basic local alignment search tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was employed (Altschul et al., 1990), which allowed for the comparison of the amplified sequences against nucleotide sequences in the NCBI database. Additionally, sequences were aligned against the reference sequence using BLAST software for more precise comparison and analysis (Wheeler et al., 2008). Chromas software was used to interpret sequencing results, including the examination of chromatogram peaks and reading of nucleotide sequences. For the detection and classification of mutations or variations in the TP53 gene, the Mutation Tester online software (https://www.genecascade.org/MutationTaster2021/#transcript) was applied to identify novel or previously reported mutations.

To evaluate differences in codon usage and amino acid sequences between normal and mutated proteins, the EXPASY (https://web.expasy.org/translate/). was employed. For analyzing the primary structure of mutated proteins, the Protter online tool (https://wlab.ethz.ch/protter/start/) was utilized to visualize the protein sequence and structural domains. Finally, to construct the three-dimensional structure mutated proteins, trRosetta software (https://yanglab.qd.sdu.edu.cn/trRosetta/) was used. This tool enabled the design of high-confidence 3D models, providing a detailed structural comparison of normal and mutated TP53 proteins for further functional analysis.

2.9 Statistical analysis

Mutation data obtained from the sequencing analyses were statistically evaluated using the SNPStats online software (https://www.snpstats.net/). This software provides comprehensive statistical approaches specifically tailored to analyze SNPs, allowing for the assessment of allele frequencies, genotype distribution, association studies, and potential correlations with clinical or pathological characteristics. Previous studies, including those by Elsaid et al., (2017) and Youssef et al., (2021), have demonstrated the reliability and robustness of SNPStats software in analyzing genetic variations, including its ability to generate odds ratios with corresponding 95% confidence intervals, further supporting its suitability for this study statistical analyses.

2.10 Homology analysis of homo sapiens (Human) and cannis lupus (Dog)

The nucleotide sequences of human and dog Exon 5 and Exon 7 regions were retrieved from the NCBI database. Sequence conservation between species was assessed using the BLAST program (https://blast.ncbi.nlm.nih.gov/Blast.cgi), applying default parameters for nucleotide-nucleotide comparisons. Alignments were examined for sequence identity, presence of gaps, and strand orientation. Conserved and mismatched positions were noted to identify potential SNPs or evolutionary differences.

3. Results

3.1 DNA extraction and genomic DNA estimation

In this study, genomic DNA was extracted from blood samples of ten breast cancer patients using the PCI (phenol/chloroform/isoamyl alcohol) method. The extracted genomic DNA was assessed through both qualitative and quantitative methods.

For qualitative estimation, gel electrophoresis was employed to evaluate the integrity of DNA, as illustrated in Fig. 2, which shows the outcomes of samples obtained from breast cancer patients. The Thermofisher 1kb Plus DNA Ladder (Lot No. #10787026) was utilized.

Gel electrophoresis of breast cancer patient samples.
Fig. 2.
Gel electrophoresis of breast cancer patient samples.

For quantitative estimation, a nanodrop Spectrophotometer 2000 was utilized to determine the concentration of genomic DNA. The optical density (OD) values were measured at a wavelength ratio of 260/280, with each sample exhibiting an OD value of approximately 1.8, indicative of pure genomic DNA. The detailed OD values for all the samples are provided in Table 5. These results confirm the successful extraction and quantification of genomic DNA, offering valuable insights into the DNA content in the tested samples.

Table 5. DNA quantification at OD 260/280 by nano-drop spectrophotometer.
Sr. no Sample name OD 260/280 Stock DNA (ng/µL) Working DNA (ng/µL)
1 BC-1 1.62 162.5 50
2 BC-2 1.70 101.5 50
3 BC-3 1.60 138.0 50
4 BC-4 1.73 106.5 50
5 BC-5 1.74 82.3 50
6 BC-6 1.62 187.9 50
7 BC-7 1.70 76.2 50
8 BC-8 1.65 55.2 50
9 BC-9 1.70 43.1 50
10 BC-10 1.74 65.5 50

BC: Breast cancer patients.

3.2 Standard PCR of exon 5 and 7

A standard PCR protocol was employed to amplify Exon 5 and Exon 7. A total of 35 cycles were carried out, utilizing an annealing temperature of 62°C to achieve a specific product as depicted in Fig. 3.

Standard PCR gel electrophoresis of (a, b) Exon 5 and 7.
Fig. 3.
Standard PCR gel electrophoresis of (a, b) Exon 5 and 7.

4. Data Analysis of Amplicon

Mutation taster (https://www.genecascade.org/MutationTaster2021/#transcript) online software was used detect the position of nucleotide variants (Steinhaus et al., 2021). The Table 6 outlines genetic variations identified in different samples, highlighting nucleotide changes, their genomic positions, and potential effects. In exon 4, a deletion of cytosine at position NM_000546.6:c.528delC causes a frameshift mutation, leading to a truncated protein (NP_000537.3:p.H178Tfs*69) and was observed in sample 4. In intron 6, a single nucleotide polymorphism (SNP) replaces adenine with guanine (NM_000546.6:c.672+62A>G), referenced as Rs1625895, and was present in samples 2, 3, 4, and 5. Another variation in intron 7 involves a cytosine deletion (NM_000546.6:c.783-56delC), identified in samples 2, 4, 5, 6, 7, and 10, which may influence splicing or regulatory functions. Additionally, a deletion of adenine in intron 8 (NM_000546.6:c.920-32delA) is noted, cataloged as Rs1266367430, and found in sample 2. While the exon variation directly impacts protein structure, the intronic changes, though non-coding, could affect gene regulation or splicing, warranting further investigation.

Table 6. Summary of identified genetic variations with nucleotide changes, predicted effects, and sample distribution.
Sr. No Nucleotide change Position Amino acid change Predicted or not Samples
1 Deletion of C in exon 4 NM_000546.6:c.528delC NP_000537.3:p.H178Tfs*69 -- 4
2 A replaced by G in intron 6 NM_000546.6:c.672+62A>G -- Rs1625895 2,3,4,5
3 Deletion of C in intron 7 NM_000546.6:c.783-56delC -- -- 2, 4, 5, 6, 7, 10
4 Deletion of A in intron 8 NM_000546.6:c.920-32delA -- Rs1266367430 2

4.1 Chromatogram analysis of TP53 gene

The results of the chromatogram analysis revealing several genetic variations within the TP53 gene. As shown in Fig.4 panel (a) shows a substitution where adenine (A) is replaced by guanine (G) in Intron 6, a genetic variation that may influence the splicing mechanism or the regulation of TP53 expression. Panel (b) highlights the deletion of cytosine (C) in Exon 4, which could potentially alter the coding sequence of the TP53 protein, leading to changes in its structure and function. Panel (c) depicts a cytosine (C) deletion in Intron 7, a variation in the non-coding region that might affect intron-exon splicing or gene regulatory elements. Finally, panel (d) reveals a deletion of adenine (A) in Intron 8, which could disrupt the normal splicing process or influence the gene’s transcriptional regulation. These genetic alterations, identified through chromatogram analysis, could have significant implications for the TP53 gene’s function, potentially impairing its tumor-suppressing role and contributing to cancer development.

The chromatogram analysis results revealed the following genetic variation: (a) Adenine replaced by Guanine (A>G) in intron 6, (b) Deletion of C in Exon 4, (c) Deletion of C in intron 7 and (d) Deletion of A in intron 8. (Arrow shows deletion and replacement)
Fig. 4.
The chromatogram analysis results revealed the following genetic variation: (a) Adenine replaced by Guanine (A>G) in intron 6, (b) Deletion of C in Exon 4, (c) Deletion of C in intron 7 and (d) Deletion of A in intron 8. (Arrow shows deletion and replacement)

4.2 Blast of reference and mutated protein

The reference protein of TP53 NP-000537.3 has 393 aa, and mutated protein has 245aa. Protein blast of both proteins showed homology of 177 amino acids. As shown in Fig. 5, the sequence of amino acid after 178 aa got change and truncated protein was formed due to early stop codon at position 246 aa.

Blast analysis of normal and mutated TP53 protein.
Fig. 5.
Blast analysis of normal and mutated TP53 protein.

The results demonstrate the consequences of a frameshift mutation on the protein-coding sequence, which was analyzed using the Expasy Translate tool. This mutation involves the deletion of a single nucleotide, which disrupts the original reading frame of the gene. As a result, the amino acid sequence remains unchanged up to position 177aa, after which the sequence shifts, producing a completely altered and nonfunctional amino acid chain.

As you can see in Fig. 6 frameshift mutation introduces an early stop codon at position 246aa. The presence of this premature stop codon results in the production of a truncated protein that is significantly shorter than the original, leading to the loss of critical functional domains required for normal protein activity. The Fig. 6 clearly illustrates this disruption, showing the abrupt change in the amino acid sequence following position 177aa and highlighting the early termination of translation. The frameshift mutation not only alters the sequence of amino acids but also affects the overall structure and stability of the protein. Such structural changes can render the protein nonfunctional or even harmful to the cell, potentially disrupting normal biological processes. This finding underscores the significance of maintaining the correct reading frame for the synthesis of a functional protein and highlights the detrimental impact of frameshift mutations on gene expression and protein function.

Frameshift mutation leading to altered amino acid sequence and early stop codon at position 246.
Fig. 6.
Frameshift mutation leading to altered amino acid sequence and early stop codon at position 246.

The 3D structure of the mutated TP53 gene is generated using trRosetta, as shown in Fig. 7(a). The primary structure of the mutated protein was modeled using the Protter tool, which provides a visual representation of transmembrane proteins. The illustration highlights the impact of the frameshift mutation on the protein’s structure. As shown in the Fig. 7(b), the frameshift mutation causes a significant alteration in the amino acid sequence starting from position 177aa, disrupting the normal structure. This mutation results in the formation of a truncated protein, terminating prematurely at position 246aa due to the introduction of a premature stop codon. The truncated protein is shown as lacking key functional domains, including critical transmembrane regions, which are essential for proper folding, stability, and function. The annotations in the Fig. 7 mark key features such as the N-glycosylation motifs (green circles), signal peptides (red crosses), and transmembrane regions (indicated by loops). The altered amino acid sequence and the premature termination are evident, demonstrating that the mutation not only disrupts the protein’s structural integrity but also renders it nonfunctional. This result underscores the critical importance of maintaining the correct reading frame to preserve protein functionality. This visual model helps to better understand the detrimental impact of this mutation at the molecular level, particularly in how it disrupts the protein’s ability to span membranes and perform its normal biological roles.

(a) 3D structure of the mutated TP53 protein, highlighting the structural alterations resulting from the variation. (b) Primary structure of the mutated TP53 showing the sequence of amino acids and the specific mutation sites.
Fig. 7.
(a) 3D structure of the mutated TP53 protein, highlighting the structural alterations resulting from the variation. (b) Primary structure of the mutated TP53 showing the sequence of amino acids and the specific mutation sites.

The secondary structure of the mutated TP53 protein was predicted using PSIPRED, a widely used tool for protein structure prediction (Fig. 8). PSIPRED employs a highly accurate, two-stage method that integrates information from multiple sequence alignments and predicts the locations of alpha helices, beta strands, and coils in the protein. This approach enables PSIPRED to provide reliable predictions even for sequences with limited homology to known structures. By applying PSIPRED to the mutated TP53 protein, we can visualize the structural changes resulting from the mutation, which may alter its functional domains and stability. This secondary structure prediction offers valuable insights into the potential effects of mutations on the protein’s folding and function, aiding in the understanding of its role in cancer development and progression.

(a) Prediction of the secondary structure of the mutated TP53 protein, illustrating the arrangement of alpha helices, beta sheets, and loops, (b) Highlighted domains within the mutated TP53 protein, emphasizing functional regions affected by the mutation.
Fig. 8.
(a) Prediction of the secondary structure of the mutated TP53 protein, illustrating the arrangement of alpha helices, beta sheets, and loops, (b) Highlighted domains within the mutated TP53 protein, emphasizing functional regions affected by the mutation.

4.3 Statistical analysis

  • 1. Deletion of C present only in 1 count. The allelic frequency for 1 count is 0.05 for cancer samples. The genotypic frequency for the C/- genotype is 0.1 in cancer samples. About 10% of cancer samples have the C/- genotype. The exact test for Hardy-Weinberg equilibrium for genotype C/- in cancer samples showed a non-significant result; p-value = 1 with 95% confidence interval. This change is not significantly associated with cancer; p-value = 0.23.

  • 2. The two alleles for second nucleotide variant are A and G. Allele G is homozygous, present in 4 counts. The allelic frequency for 4 counts is 0.2 for cancer samples. The genotypic frequency for the G/G genotype is 0.8 in cancer samples. About 40% of cancer samples have the G/G genotype. The exact test for Hardy-Weinberg equilibrium for genotype G/G in cancer samples showed a non-significant result; p-value = 1 with 95% confidence interval. This change is significantly associated with cancer; p-value = 0.01.

  • 3. Deletion of C present only in present in 6 counts. The allelic frequency for 6 counts is 0.3 for cancer samples. The genotypic frequency for the C/- genotype is 0.6 in cancer samples. About 60% of cancer samples have the C/- genotype. The exact test for Hardy-Weinberg equilibrium for genotype C/- in cancer samples showed a non-significant result; p-value = 0.48 with 95% confidence interval. This change is significantly associated with cancer; p-value = 0.0009.

  • 4. Deletion of A present only present in 1 count. The allelic frequency for 1 count is 0.05 for cancer samples. The genotypic frequency for the A/- genotype is 0.1 in cancer samples. About 10% of cancer samples have the A/C genotype. The exact test for Hardy-Weinberg equilibrium for genotype A/- in cancer samples showed a non-significant result; p-value = 1 with 95% confidence interval. This change is not significantly associated with cancer; p-value = 0.23.

4.4 Homology analysis of homo sapiens (Human) and cannis lupus (Dog)

The BLAST analysis results demonstrate significant sequence conservation between human and dog Exon 5 and Exon 7 regions, as shown in Fig. 9. Exon 5 shows a high alignment score of 146 bits with an E-value of 2e-40, indicating a highly significant match. The sequence identity is 88% (100 out of 113 nucleotides), with no gaps observed, highlighting a continuous and well-aligned region in the same orientation (Plus/Plus strand). In comparison, Exon 7 also exhibits strong conservation, with a score of 135 bits and an E-value of 5e-37. The identity is slightly lower at 83% (106 out of 127 nucleotides), but like Exon 5, it has no gaps and aligns in the same orientation. The yellow highlights in both alignments mark mismatched positions, which likely represent SNPs or evolutionary differences. Overall, Exon 5 appears to be more conserved than Exon 7, with both exons showing no major structural differences, emphasizing their evolutionary significance across species.

(a, b) Comparative homology analysis of Homo sapiens and Canis lupus TP53 exon 5 and exon 7.
Fig. 9.
(a, b) Comparative homology analysis of Homo sapiens and Canis lupus TP53 exon 5 and exon 7.

5. Discussion

The 53-kDa nuclear phosphoprotein, which is produced from the TP53 tumor suppressor gene, primarily serves to maintain the stability of the genome by engaging in tasks such as DNA repair, halting the progression of the cell cycle, and promoting cell apoptosis (Fig. 10) (Lane, 1992). In recent years, researchers have uncovered numerous pathways in which TP53 plays a role, including autophagy, cell metabolism, ferroptosis, and pathways involving the generation of reactive oxygen species. In some of these pathways, TP53 doesn’t directly transmit signals as a transcription factor but rather through its interactions with other proteins. For instance, in apoptosis, the activation of this pathway can occur through TP53’s interaction with anti-apoptotic proteins found in the mitochondria (Borrero and El-Deiry, 2021). As shown in Fig. 10, this interaction plays a pivotal role in various cellular responses, including cell cycle arrest, DNA repair, apoptosis, and senescence.

Mechanisms of TP53 activation and DNA damage response pathways. This Fig. shows the TP53 response to DNA damage through key signaling pathways. DNA damage activates ATM and ATR kinases, which phosphorylate CHK1 and CHK2, leading to TP53 stabilization. Activated TP53 enters the nucleus and regulates genes involved in cell cycle arrest, DNA repair, apoptosis, or senescence. Mouse double minute 2 homolog (MDM2) usually degrades TP53, but ARF can inhibit MDM2 under oncogenic stress, allowing TP53 to stabilize. This pathway helps maintain genomic integrity by repairing or removing damaged cells. Mutations in TP53, particularly in exons 6 and 8, can disrupt this protective function, promoting cancer development.
Fig. 10.
Mechanisms of TP53 activation and DNA damage response pathways. This Fig. shows the TP53 response to DNA damage through key signaling pathways. DNA damage activates ATM and ATR kinases, which phosphorylate CHK1 and CHK2, leading to TP53 stabilization. Activated TP53 enters the nucleus and regulates genes involved in cell cycle arrest, DNA repair, apoptosis, or senescence. Mouse double minute 2 homolog (MDM2) usually degrades TP53, but ARF can inhibit MDM2 under oncogenic stress, allowing TP53 to stabilize. This pathway helps maintain genomic integrity by repairing or removing damaged cells. Mutations in TP53, particularly in exons 6 and 8, can disrupt this protective function, promoting cancer development.

TP53 mutation remains the most widely identified genetic alteration observed in human cancer development. Within the context of breast cancer, TP53 mutation is associated with more aggressive disease and poorer survival outcomes. However, the frequency of TP53 mutation in breast cancer is relatively lower compared to its occurrence in other types of solid tumors. Both hereditary and epigenetic alterations have been identified in regulators of TP53 function, as well as in certain downstream genes controlled by TP53, in breast tumors that have a normal TP53 gene sequence. Analysing the molecular abnormalities in the structure and expression of components within the TP53 pathway is likely to hold significance in diagnosing breast cancer, predicting prognosis, and eventually guiding treatment strategies (Gasco, Shami and Crook, 2002). Previous studies have attempted to establish a connection between alterations in different aspects of the TP53 gene and the prognosis of individuals with breast cancer (Børresen et al., 1992; Bergh et al., 1995). Some studies indicated that individuals with alterations in the L2/L3 region experienced worse survival outcomes compared to those with transformed patients located outside these specific areas. However, in a recent research, regarding the connection between lymph node partnerships and dependencies, there was an observed positive correlation between steroids and patients testing positive for steroids, although this association only reached marginal significance (Powell et al., 2000). Mutations at the TP53 locus have been commonly associated with the inactivation of TP53 negative regulatory effects on cell proliferation. However, certain observations deviate from this concept. Notably, TP53 mutations are identified in merely around 30% of breast cancer cases, in contrast to colon cancers, 70% 6 of which have TP53 mutations (Hollstein et al., 1991) (Levine, Momand and Finlay, 1991) (Baker et al., 1990). Evidence suggests that TP53 mutations vary significantly across different tumor types (Bykov et al., 2018) (Hollstein et al., 1991). According to the cBioPortal for Cancer Genomics (cBioPortal for Cancer Genomics, no date), the overall TP53 mutation frequency in tumor samples from 10,000 cancer patients stands at 42%. However, mutation rates differ by tumor type, with high frequencies in small cell lung cancer (89.02%) and colorectal cancer (72.69%). In contrast, TP53 mutations are less common in cancers such as thyroid, cervical, and bone cancers. Different tumor types also show distinct mutation patterns; for example, lung and liver cancers predominantly exhibit G:C to T:A transversions, whereas colorectal cancers, brain tumors, and leukemia are associated with CpG dinucleotide hotspot transitions. In esophageal cancer, mutations in A:T base pairs are more frequently observed (Chen et al., 2022) (Hollstein et al., 1991). The TP53 mutation spectrum varies across tumor subtypes within the same organ (Muller and Vousden, 2014). In an analysis of 572 breast cancers, luminal subtypes predominantly exhibited missense mutations, especially A:T to G:C transitions, whereas basal subtypes had a higher frequency of truncating mutations (Dumay et al., 2013). Additionally, the TP53 mutation profile in tumors is influenced by environmental carcinogens. For instance, ultraviolet radiation commonly induces CC to TT base transitions in invasive skin squamous cell carcinoma, while smokers display more G to T transversions in TP53 in lung cancer than non-smokers (Pfeifer et al., 2002). Aflatoxin B1 exposure is linked to G:C to T:A transversions at codon 249 of TP53 in primary hepatocellular carcinoma (Kucab, Phillips and Arlt, 2010). Mutations in TP53 are also associated with poorer prognosis in many cancers (TP53 mutations in human cancers: functional selection and impact on cancer prognosis and outcomes - PubMed, no date). Data from the cBioPortal for Cancer Genomics indicates that mutant TP53 expression correlates with reduced overall survival rates in cancers such as breast, pancreatic, hepatobiliary, bone, non-small cell lung, and thyroid cancers.

In previous study introns 6 and 8 contained 400 and 79 bp, respectively. The 10 bp flanking region in each Exon-intron junction have been reported in their studies. The sequences determined with reported excluding at the 3’ end of intron 5, where they found one extra C within the last 10 bp. At the splice junction site the addition of the C matched with the consensus sequence (Murine p53 intron sequences 5–8 and their use in polymerase chain reaction/direct sequencing analysis of p53 mutations in CD‐1 mouse liver and lung tumors - Goodrow - 1992 - Molecular Carcinogenesis - Wiley Online Library, no date).

This study identifies several genetic mutations with potential implications in breast cancer pathogenesis. Among the findings, a deletion mutation in exon 4 resulting in a truncated protein likely has a profound effect on protein function. Similar truncating mutations have been previously reported in breast cancer, highlighting their potential to disrupt tumor suppressor gene functions, such as those associated with TP53, thereby promoting cancer progression (Pinto et al., 2022) (Rivlin et al., 2011) (Qayoom et al., 2024). In contrast, the intronic variants identified in this study, while not directly altering protein structure, may contribute to splicing anomalies or affect gene regulatory elements. Prior studies have demonstrated that intronic variants can influence alternative splicing patterns or modify enhancer activities, leading to dysregulated gene expression in breast cancer (Alternative splicing and cancer: a systematic review | Signal Transduction and Targeted Therapy, no date) (Wessagowit et al., 2005) (Rigau et al., 2019) (Torabi Dalivandan, Plummer and Gayther, 2021).

Compared to prior research, our findings align with those of, who reported that frameshift mutations in coding regions often correlate with aggressive tumor phenotypes (Chang et al., 2005). Meanwhile, the role of intronic mutations remains less explored but has been suggested by Zhang et al. to affect splicing fidelity and contribute to tumor heterogeneity (Zhang, Ai and Abdel-Wahab, 2024). Unlike previous studies, which focused solely on coding or regulatory mutations, this study provides a comprehensive analysis encompassing both exon and intronic variations, offering a broader perspective on their combined roles in breast cancer.

Comparative genomics has proven to be a powerful tool for interpreting genome function across species. Large-scale analyses, such as those reported by Lindblad-Toh et al. (Lindblad-Toh et al., 2011) demonstrate that at least 5.5% of the human genome has undergone purifying selection, with constrained elements covering approximately 4.2% of the genome. These conserved regions include coding exons and regulatory elements, highlighting their functional importance. In the context of our study, the high sequence conservation observed between human and dog Exon 5 and Exon 7 aligns with these findings, suggesting that these exons are under evolutionary constraints and may play critical roles in gene regulation and protein function. This further supports the use of canine models to study human gene function and potential disease mechanisms.

Further investigations using larger sample sizes, transcriptomic profiling, and proteomic analyses are necessary to validate these findings and unravel the full extent of their functional implications. The identification of such mutations may aid in refining diagnostic tools and developing targeted therapies, ultimately improving patient outcomes in breast cancer.

6. Conclusions

The present study successfully identified and characterized several genetic variations within the TP53 gene, demonstrating potential associations with breast cancer pathogenesis. Notably, the frameshift mutation due to a cytosine deletion in exon 4 results in a significantly truncated and structurally compromised protein, potentially impairing TP53 critical tumor-suppressor function. Additionally, several intronic variations were identified, particularly the homozygous nucleotide substitution (A>G) in intron 6 and cytosine deletions in intron 7, showing statistically significant associations with breast cancer. Although certain deletions showed no significant statistical correlation with cancer in this small cohort, their functional implications should not be disregarded without further investigation.

Future studies should focus on larger-scale cohort analyses to validate and strengthen the statistical significance of the genetic variations identified in this research. Additionally, advanced functional validation experiments, including transcriptomic profiling, RNA sequencing, and proteomic analyses, should be conducted to elucidate the precise molecular mechanisms through which intronic and exon mutations influence breast cancer progression. Moreover, there is substantial scope for exploring these genetic variants as potential biomarkers for early detection, prognosis, and therapeutic monitoring in breast cancer patients. Ultimately, research aimed at developing targeted therapies addressing these specific genetic alterations could significantly contribute to personalized medicine, offering improved therapeutic outcomes and enhancing overall patient care.

Acknowledgment

The authors sincerely thank the South African Research Chairs initiative of the Department of Science and Technology and the National Research Foundation (NRF) of South Africa, Global Excellence Stature (GES) for doctoral bursary, South African Medical Research Council (SAMRC), and Laser Research Centre (LRC), University of Johannesburg. The research reported in this review article was supported by the South African Medical Research Council (SAMRC) through its Division of Research Capacity Development under the Research Capacity Development Initiative from funding received from the South African National Treasury. The content and findings reported/illustrated are the sole deduction, view, and responsibility of the researchers and do not reflect the official position and sentiments of the SAMRC.

CRediT authorship contribution statement

Mehak Zahra: Conceptualization, writing - original draft preparation; Wajeeha Tariq: Writing - review and editing; Muhammad Wasim, Blassan P. George, Heidi Abrahamse: Writing - review, editing and supervision. All authors have read and agreed to the published version of the manuscript.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

Data are available upon request to the corresponding author.

Declaration of generative AI and AI-assisted technologies in the writing process

The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.

Funding

This work is based on the research funded by the South African Research Chairs Initiative of the Department of Science and Technology and the National Research Foundation (NRF) of South Africa (Grant No. 98337), the South African Medical Research Council (Grant No. SAMRC EIP007/2021), as well as the grants received from the NRF Research Development Grants for Y-Rated Researchers (Grant No: 137788), CSIR African Laser Centre Research Grant (HLHA26X Task ALC-R001) the University Research Committee (URC), the University of Johannesburg, and the Council for Scientific Industrial Research (CSIR)-National Laser Centre (NLC).

References

  1. , , . Overexpression of p53 gene has an important role in induction and progression of breast carcinoma. Qad Med J. 2017;12:77-85. https://doi.org/10.28922/qmj.2016.12.21.77-85
    [Google Scholar]
  2. , , , , . Basic local alignment search tool. J Mol Biol. 1990;215:403-410. https://doi.org/10.1016/S0022-2836(05)80360-2
    [Google Scholar]
  3. , , , , , . Prognostic significance of TP53 alterations in breast carcinoma. Br. J Cancer. 1993;68:540-548. https://doi.org/10.1038/bjc.1993.383
    [Google Scholar]
  4. , , . Assessing the risk of breast cancer. N Engl J Med. 2000;342:564-571. https://doi.org/10.1056/NEJM200002243420807
    [Google Scholar]
  5. , , , , . Suppression of human colorectal carcinoma cell growth by wild-type p53. Science. 1990;249:912-915. https://doi.org/10.1126/science.2144057
    [Google Scholar]
  6. , , , , . Complete sequencing of the p53 gene provides prognostic information in breast cancer patients, particularly in relation to adjuvant systemic therapy and radiotherapy. Nat Med. 1995;1:1029-1034. https://doi.org/10.1038/nm1095-1029
    [Google Scholar]
  7. , , , , , , , , , . Screening for germ line TP53 mutations in breast cancer patients. Cancer Res. 1992;52:3234-3236.
    [Google Scholar]
  8. , . The clinical significance of p53 aberrations in human tumors. Virchows Arch. 1995;427:229-241. https://doi.org/10.1007/BF00203389
    [Google Scholar]
  9. , , , . Targeting mutant p53 for efficient cancer therapy. Nat Rev Cancer. 2018;18:89-102. https://doi.org/10.1038/nrc.2017.109
    [Google Scholar]
  10. Cancer tomorrow WHO, cancer tomorrow, world health organization, 2024. [accessed 2024 Oct 30]. Available from: WHO, cancer tomorrow, world health organization, 2024. https://gco.iarc.who.int/today/
  11. Cbioportal for cancer genomics. [accessed 2024 Nov 14]. Available from: https://www.cbioportal.org/.
  12. , , , , , , , , , . High frequency of frameshift mutation on p53 gene in Taiwanese with non small cell lung cancer. Cancer Lett. 2005;222:195-204. https://doi.org/10.1016/j.canlet.2004.11.020
    [Google Scholar]
  13. , , , , , , , , , , , , . Mutant p53 in cancer: From molecular mechanism to therapeutic modulation. Cell Death Dis. 2022;13:974. https://doi.org/10.1038/s41419-022-05408-1
    [Google Scholar]
  14. . Epidemiology of breast cancer in women. In: Advances in experimental medicine and biology, breast cancer metastasis and drug resistance Advances in experimental medicine and biology, breast cancer metastasis and drug resistance. Cham: Springer International Publishing; p. :9-29. https://doi.org/10.1007/978-3-030-20301-6_2
    [Google Scholar]
  15. , . Epidemiology of breast cancer in women. In: Breast cancer metastasis and drug resistance Breast cancer metastasis and drug resistance. New York, NY: Springer New York; p. :19-34. https://doi.org/10.1007/978-1-4614-5647-6_2
    [Google Scholar]
  16. , . Breast cancer as a global health concern. Cancer Epidemiol. 2009;33:315-318. https://doi.org/10.1016/j.canep.2009.10.003
    [Google Scholar]
  17. , . NanoDrop microvolume quantitation of nucleic acids. J Vis Exp. 2010;2565 https://doi.org/10.3791/2565
    [Google Scholar]
  18. , , , , , , , , , , , , . Distinct tumor protein p53 mutants in breast cancer subgroups. Int J Cancer. 2013;132:1227-1231. https://doi.org/10.1002/ijc.27767
    [Google Scholar]
  19. , , , , , . Prognostic significance of p53 gene alterations in node-negative breast cancer. Breast Cancer Res Treat. 1993;26:225-235. https://doi.org/10.1007/BF00665800
    [Google Scholar]
  20. , , , , . Association of monoallelic MUTYH mutation among Egyptian patients with colorectal cancer. Fam Cancer. 2017;16:83-90. https://doi.org/10.1007/s10689-016-9927-z
    [Google Scholar]
  21. , , . The p53 pathway in breast cancer. Breast Cancer Res. 2002;4:70-76. https://doi.org/10.1186/bcr426
    [Google Scholar]
  22. , , , , , . Murine p53 intron sequences 5–8 and their use in polymerase chain reaction/direct sequencing analysis of p53 mutations in CD‐1 mouse liver and lung tumors. Molecular Carcinogenesis. 1992;5:9-15. https://doi.org/10.1002/mc.2940050105
    [Google Scholar]
  23. , . Review of cancer from perspective of molecular. J Cancer Res Pract. 2017;4:127-129. https://doi.org/10.1016/j.jcrpr.2017.07.001
    [Google Scholar]
  24. , . Tumor suppressor p53: Biology, signaling pathways, and therapeutic targeting. Biochim Biophys Acta Rev Cancer. 2021;1876:188556. https://doi.org/10.1016/j.bbcan.2021.188556
    [Google Scholar]
  25. , , . Germline mutations and polymorphisms in the origins of cancers in women. J Oncol. 2010;2010:297671. https://doi.org/10.1155/2010/297671
    [Google Scholar]
  26. , , , . p53 mutations in human cancers. Science. 1991;253:49-53. https://doi.org/10.1126/science.1905840
    [Google Scholar]
  27. , . Molecular epidemiology and carcinogenesis: Endogenous and exogenous carcinogens. Mutat Res. 2000;462:311-322. https://doi.org/10.1016/s1383-5742(00)00015-6
    [Google Scholar]
  28. , , , , , , , , . Germline p16 mutations in familial melanoma. Nat Genet. 1994;8:15-21. https://doi.org/10.1038/ng0994-15
    [Google Scholar]
  29. , , . Linking environmental carcinogen exposure to TP53 mutations in human tumors using the human TP53 knock-in (Hupki) mouse model. FEBS J. 2010;277:2567-2583. https://doi.org/10.1111/j.1742-464X.2010.07676.x
    [Google Scholar]
  30. . p53, guardian of the genome. Nature. 1992;358:15-16. https://doi.org/10.1038/358015a0
    [Google Scholar]
  31. , , . The p53 tumor suppressor gene. Nature. 1991;351:453-456. https://doi.org/10.1038/351453a0
    [Google Scholar]
  32. , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , . A high-resolution map of human evolutionary constraint using 29 mammals. Nature. 2011;478:476-482. https://doi.org/10.1038/nature10530
    [Google Scholar]
  33. , , , , , , , , . Incidence and outcome of male breast cancer: An international population-based study. J Clin Oncol. 2011;29:4381-4386. https://doi.org/10.1200/JCO.2011.36.8902
    [Google Scholar]
  34. , . Mutant p53 in cancer: New functions and therapeutic opportunities. Cancer Cell. 2014;25:304-317. https://doi.org/10.1016/j.ccr.2014.01.021
    [Google Scholar]
  35. , . Comparative oncology today. Vet. Clin. North Am Small Anim Pract. 2007;37:1023-1032. https://doi.org/10.1016/j.cvsm.2007.08.003
    [Google Scholar]
  36. , , , , , . Tobacco smoke carcinogens, DNA damage and p53 mutations in smoking-associated cancers. Oncogene. 2002;21:7435-7451. https://doi.org/10.1038/sj.onc.1205803
    [Google Scholar]
  37. , , , , , , , , , , , , , , , , . Clinical and functional significance of TP53 Exon 4-intron 4 splice junction variants. Mol Cancer Res. 2022;20:207-216. https://doi.org/10.1158/1541-7786.MCR-21-0583
    [Google Scholar]
  38. , , , , . Prognostic significance of mutations to different structural and functional regions of the p53 gene in breast cancer. Clin Cancer Res. 2000;6:443-451. https://aacrjournals.org/clincancerres/article/6/2/443/288033/Prognostic-Significance-of-Mutations-to-Different
    [Google Scholar]
  39. , , , , , . Targeting mutant p53: A key player in breast cancer pathogenesis and beyond. Cell Commun Signal. 2024;22:484. https://doi.org/10.1186/s12964-024-01863-9
    [Google Scholar]
  40. , , , . Intronic CNVs and gene expression variation in human populations. PLoS Genet. 2019;15:e1007902. https://doi.org/10.1371/journal.pgen.1007902
    [Google Scholar]
  41. , , , . Mutations in the p53 tumor suppressor gene: Important milestones at the various steps of tumorigenesis. Genes & Cancer. 2011;2:466-474. https://doi.org/10.1177/1947601911408889
    [Google Scholar]
  42. , . Breast cancer epidemiology and risk factors. Clin Obstet Gynecol. 2016;59:651-672. https://doi.org/10.1097/GRF.0000000000000239
    [Google Scholar]
  43. , , . Dog models of naturally occurring cancer. Trends Mol Med. 2011;17:380-388. https://doi.org/10.1016/j.molmed.2011.02.004
    [Google Scholar]
  44. , . Purification of nucleic acids by extraction with phenol:chloroform. CSH Protoc. 2006;2006:pdb.prot4455. https://doi.org/10.1101/pdb.prot4455
    [Google Scholar]
  45. , , . DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA. 1977;74:5463-5467. https://doi.org/10.1073/pnas.74.12.5463
    [Google Scholar]
  46. , . Exploiting the hallmarks of cancer: The future conquest of breast cancer. Eur J Cancer. 2003;39:1668-1675. https://doi.org/10.1016/s0959-8049(03)00273-9
    [Google Scholar]
  47. , , , , , . MutationTaster2021. Nucl Acids Res. 2021;49:W446-W451. https://doi.org/10.1093/nar/gkab266
    [Google Scholar]
  48. , , . Risks and function of breast cancer susceptibility alleles. Cancers (Basel). 2021;13:3953. https://doi.org/10.3390/cancers13163953
    [Google Scholar]
  49. TP53 mutations in human cancers: Functional selection and impact on cancer prognosis and outcomes - PubMed. [accessed 2024 Nov 14]. Available from: https://pubmed.ncbi.nlm.nih.gov/17401424/.
  50. , , , . Normal and abnormal mechanisms of gene splicing and relevance to inherited skin diseases. J Dermatol Sci. 2005;40:73-84. https://doi.org/10.1016/j.jdermsci.2005.05.006
    [Google Scholar]
  51. , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , . Database resources of the national center for biotechnology information. Nucleic Acids Res. 2008;36:D13-D21. https://doi.org/10.1093/nar/gkm1000
    [Google Scholar]
  52. , , , , , , . Association of GSTP1 p.Ile105Val (rs1695, c.313A > G) Variant with the risk of breast carcinoma among Egyptian women. Biochem Genet. 2021;59:1487-1505. https://doi.org/10.1007/s10528-021-10070-x
    [Google Scholar]
  53. , , , . Alternative splicing and cancer: A systematic review. Signal Transduct Target Ther. 2021;6:78. https://doi.org/10.1038/s41392-021-00486-7
    [Google Scholar]
  54. , , . Molecular impact of mutations in RNA splicing factors in cancer. Mol Cell. 2024;84:3667-3680. https://doi.org/10.1016/j.molcel.2024.07.019
    [Google Scholar]
Show Sections